... without any realization of the task The morning wore on The doctors, one at a time came down, and the nurse came down, and they ate a hearty breakfast Maria watched them, and hated them because they ... his pajamas, and approach the bed “What on earth is the matter?” he said He also laid hands on Maria, and, at his touch, she became able to move “What on earth is the matter?” he asked again “She ... regarded the whole as the antics of infancy The Lees lived near the Edghams, on the same street, and Mrs Lee and Aunt Maria had exchanged several calls They were, in fact, almost intimate The Lees...
Ngày tải lên: 16/03/2014, 18:20
... 196:S63-S75 Abstract Gasana M, Vandebriel G, Kabanda G, et al.: Tuberculosis in Rwanda: challenges to reaching the targets Bull WHO 2007, 85:383-384 International epidemiologic databases to evaluate AIDS: ... clinical and virologic outcomes in patients with both TB and HIV disease in need of treatA Common TB and HIV Paradigm An Alternative TB and HIV Paradigm Collaboration of Programs National TB Program ... collaboration and integration and their relevance to the specific setting These models may range from maintenance of separate programs and services with enhanced communication and referral mechanisms...
Ngày tải lên: 20/06/2014, 08:20
Sectors and Styles - A New Approach to Outperforming the Market docx
... whom I am proud to call friends and colleagues Many thanks go to Jason and Jane Welsch, Bharath Chandar, Joseph Roccasalvo, George and Andrea Fulop, Emily and Len Brizzi, Gino and Donna Albertario, ... markets’ take on both It is a rich and robust way to analyze all the important aspects of both the real economy (the G and E part) and the financial economy (M) so that our analysis and conclusions about ... companies, government, and the markets and, thereby, quality original investment research Thanks to the PC and the Net, an investor has at his/her disposal the essential communications and analytical...
Ngày tải lên: 28/06/2014, 21:20
Social media and the 7 steps of Buiding a new media strategy
... SERVICE DIGITAL AND TRADITIONAL DESIGN & DEVELOPMENT Website design and development Web application and data gathering backend design, development and management Print collateral design and development ... value in the message itself MEDIA-ENABLED SOCIALIZATION AKA SOCIAL MEDIA The term ‘Social Media’ is backward ‘Social’ should not describe ‘media’, ‘media’ describes the means of socialization Focus ... products and services to grow brands & sales CAPABILITIES: CONTENT MARKETING Blogs Video assets iPhone and Facebook apps Podcasts eBooks (developed on the iPad and NOOK friendly ePub standard) Email...
Ngày tải lên: 03/07/2014, 09:44
Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt
... 6(2): Dandona P, Aljada A, Chaudhuri A, Bandyopadhyay A: The potential influence of inflammation and insulin resistance on the pathogenesis and treatmentof atherosclerosis-related complications in ... be fading, there comes news of the surprisingly beneficial effect of GIK in treating the critically ill Already both the American College of Cardiology and the American Heart Association have ... as tumor necrosis factor-α and interleukin1, that can activate synovial fibroblasts and other cells to produce matrix metalloproteinases involved in the degradation of cartilage" [71] As Dinarello...
Ngày tải lên: 11/08/2014, 10:23
Tài liệu Creating a New Access Database pptx
... DDL and Security (ADOX) extends the ADO objects and programming model with objects for schema creation and modification, and for security ADOX is used to programmatically access and manipulate the ... in a database You can use ADOX from NET through COM interop to create a new Microsoft Access database Use the Create( ) method of the ADOX.Catalog object, passing a connection string for the new ... @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + fileName + ";"; // Use ADOX to create the Access database ADOX.Catalog cat = new ADOX.Catalog( ); try { cat.Create(connectString); } finally { cat = null; } } Discussion ADO...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Creating a New SQL Server Database doc
... objects are defined using DDL The solution executes a DDL CREATE DATABASE statement to create a new database on a SQL Server You can programmatically drop the database by using the DROP DATABASE statement ... statement in a similar way To drop the database created in the previous example, use the following code: DROP DATABASE MyDatabase The DROP DATABASE statement will fail if the database is in use; therefore, ... // Create the command to create the database SqlCommand cmd = new SqlCommand(sqlText, conn); // Create the new database try { conn.Open( ); cmd.ExecuteNonQuery( ); sb.Append("DataBase created...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA ... on a human prostate Marathon-Ready cDNA (Clontech, Mountain View, CA, USA) Two fragments were isolated and confirmed by Southern analysis using the internal cDNA fragment as the probe and by DNA ... DESC1 The reactive loop sequences are Val-Ser-Ala-ArgflMet-Ala-Pro and Phe-Thr-Phe-ArgflSer-Ala-Arg for PAI-1 and PCI, respectively [6] By contrast, the reactive site loops of a1 -antichymotrypsin and...
Ngày tải lên: 19/02/2014, 00:20
Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc
... Innovative applications of artificial intelligence, AAAI’97/IAAI’97, pages 598–603 AAAI Press Michael Collins and Terry Koo 2005 Discriminative reranking for natural language parsing Computational ... Computational Linguistics Wenbin Jiang, Liang Huang, and Qun Liu 2009 Automatic adaptation of annotation standards: Chinese word segmentation and POS tagging – a case study In Proceedings of the Joint ... (9) The other probabilities can be estimated in the same way 4.4 Summary of the Generative Story We make a brief summary of our generative story for the integrated morphological and syntactic parsing...
Ngày tải lên: 17/03/2014, 00:20
Postal banking in the United States and Japan: a comparative analysis docx
... fallen well below that level And, in fact, the figures show that postal savings did have at least a modest interest advantage from the mid-1930s until the early 1950s, and this advantage was at ... building) and loan associations than they were at banks, but they started growing rapidly a few years earlier, in 1929, and continued until the late 1930s Commercial bank failures, on the other hand, ... throughout the discussion of starting a postal savings bank Advocates invariably cited the predicament of rural citizens who lived many miles from a bank, and the lack of savings facilities available...
Ngày tải lên: 29/03/2014, 07:20
Respiratory Disease and Infection - A New Insight http Edited by Bassam H. Mahboub and Mayank Vats ppt
... human plasma as an inactive form and can be activated by three different pathways: the classical pathway, the alternative path‐ 15 16 Respiratory Disease and Infection - A New Insight way and the ... Wahyu Surya, Al-Jumaily, Iara Maria Sequeiros, Nabil Jarad, Sameera M Al Johani, Javed Akhter, Sara E Cruz-Morales, Jennifer Lira-Mandujano, M Carmen Míguez-Varela Published by InTech Janeza ... Peñafiel Saldías, Orlando Díaz Patiño and Pablo Aguilera Fuenzalida Chapter Pneumonia in Children 137 Irena Wojsyk-Banaszak and Anna Bręborowicz VI Contents Chapter Cystic Fibrosis Pulmonary Exacerbation...
Ngày tải lên: 30/03/2014, 18:20
not just a living the complete guide to creating a business that gives you a life
... career led me instead to Houston and then Dallas New York, the media capital, seemed an inaccessible distance away from these comparative backwaters Few journalists from Texas were able to make ... such as balance and flexibility."2 Men and couples can and also start businesses to make it easier to care for their children Canadians Cathy-Ann Glockner and Kelly Toole started a business making ... game called Magic: The Gathering He was good at it, too—enough that his team took second place in an international Magic: The Gathering tournament and wound up on the cover of a hobbyist magazine...
Ngày tải lên: 01/06/2014, 10:25
the rise of modern philosophy a new history of western philosophy volume 3 sep 2006
... beginning and one at its end, Descartes and Kant Descartes was a standardbearer for the rebellion against Aristotle In metaphysics he rejected the notions of potentiality and actuality, and in philosophical ... one aYrmative and one negative, with similar subject, predicate and verb, he produced the following: ‘Gaynsaying shewsayes are two shewsayes, the one a yeasaye and the other a naysaye, changing ... the senses and the intellect that had been divided and distorted by both empiricists and rationalists The hallmark of Cartesian dualism was the separation between mind and matter, conceived as...
Ngày tải lên: 11/06/2014, 10:31
Báo cáo sinh học: " Virology on the Internet: the time is right for a new journal" docx
... countries (and institutions) will be able to read the same material as wealthier ones (although creating access to the Internet is another matter [10]) This is particularly relevant in virology as many ... Virology Journal 2004, 1:1 Second, the information available to researchers will not be limited by their library's budget, and the widespread availability of articles will enhance literature searching ... experts in the field Once the reviewers have provided their feedback, the monitoring editor makes the final recommendation Managing Editor, David Sander will be available to assist authors with...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) ... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA PB2 PB2/6U PB2/85 PB2/34 ... a in 5' end non coding sequencea AGCAGUAGCAAGAGGAUUU(UUA) AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Virology on the Internet: the time is right for a new journal" pdf
... countries (and institutions) will be able to read the same material as wealthier ones (although creating access to the Internet is another matter [10]) This is particularly relevant in virology as many ... Virology Journal 2004, 1:1 Second, the information available to researchers will not be limited by their library's budget, and the widespread availability of articles will enhance literature searching ... experts in the field Once the reviewers have provided their feedback, the monitoring editor makes the final recommendation Managing Editor, David Sander will be available to assist authors with...
Ngày tải lên: 20/06/2014, 04:20
báo cáo khoa học: "Synchronous perforation of non-Hodgkin’s lymphoma of the small intestine and colon: a case report" ppsx
... repeat CT scan of the abdomen and pelvis revealed leakage into the abdominal cavity (Figure 6) Urgent re-exploration of the abdominal cavity revealed a moderate amount of contrast material and ... clinical and pathological features of the jejunum After the Figure Transmural necrotic tract through the intestinal wall and lymphoma Fecal content overlies the zone of necrosis and coats the tract ... All authors read and approved the final manuscript MD reviewed the literature and participated in writing the abstract, introduction, and discussion sections FB participated in writing the case...
Ngày tải lên: 11/08/2014, 00:22
Analysis of the vp2 gene sequence of a new mutated mink enteritis parvovirus strain in PR China ppt
... and the reverse primer sequence was 5'TCTAAGGGCAAACCAACCAACCACC-3' (nt 2,2922,317) The size of the resulting product was 1,999 bp The fecal samples from the mink that had been infected naturally ... equal contribution as L-CL All of the authors read and approved the final manuscript Acknowledgements This work was supported by Jilin five star animal health pharmaceutical company Author Details ... such as alterations in the alpha, amphipathic regions and tum regions forecasted by DNASTAR software At the phylogenetic level, the vp2 gene sequences of the MEV-DL and ZYL-1, as well as the vp2...
Ngày tải lên: 12/08/2014, 04:20
Lauching and developing a new product and brand
... fast And there are more and more young and modern people working in the environments Their eating habits are also becoming changed day by day and fast food has become more and more popular and ... Minh, they have a very big advantages of very good view and wonderful atmosphere like Window Cafe, Dau An Cafe, Chot Nho Cafe, Panoma Cafe, Manna Cafe, Bo Gia Ice Cream, CIAO Cafe, Star Cafe, ... competitors are KFC, Lotteria, Rita and so on In natural drink, it has some new and active competitors are Ong Tien, Nuoc Mia Sach, Tra Chan Chau and other cafes Moreover, it has some internationally...
Ngày tải lên: 24/11/2014, 01:32
Risk and regulation a new era for capitalism
... Risk and regulation: A new era for capitalism Bright spots Not all regions have been affected equally, and there are variations within markets According to Ashraf Allam, managing director for the ... from the research are highlighted below Capitalism has “fundamentally changed” The long-held faith in free markets appears to be at an end, and Adam Smith’s “invisible hand” appears to be malfunctioning ... Risk and regulation: A new era for capitalism New world order O ur research reveals a global business community alarmed and chastened by the depth and severity of the downturn The financial crisis...
Ngày tải lên: 06/12/2015, 23:11