opengl es a gentle introduction

A Gentle Introduction to the - Spring Framework

A Gentle Introduction to the - Spring Framework

... matchDao.setDataSource(dataSource); DefaultTournamentMatchManager tournamentMatchManager = new DefaultTournamentMatchManager(); tournamentMatchManager.setMatchDao(matchDao); new SwingApplication(tournamentMatchManager); ... matchDao.setDataSource(dataSource); DefaultTournamentMatchManager tournamentMatchManager = new DefaultTournamentMatchManager(); tournamentMatchManager.setMatchDao(matchDao); new SwingApplication(tournamentMatchManager); } ... com.apress.springbook.chapter01.DefaultTournamentMatchManager; public class SwingApplication { private TournamentMatchManager tournamentMatchManager; public SwingApplication(TournamentMatchManager tournamentMatchManager) { this.tournamentMatchManager...

Ngày tải lên: 05/10/2013, 04:20

22 501 1
common lisp a gentle introduction

common lisp a gentle introduction

... language has matured in many ways over the years, lists remain its central data type Lists are important because they can be made to represent practically anything: sets, tables, and graphs, and ... expressions are evaluated, how functions are applied to arguments, and how variables are created and bound The different roles of EVAL and APPLY, the scoping of variables, and the nesting of lexical contours ... The idea that programmers should expresss their ideas in familiar mathematical notation, and the computer should be the one to translate these expressions into assembly language, was a radical innovation...

Ngày tải lên: 04/04/2014, 21:42

587 133 0
nanotechnology. a gentle introduction to the next big idea, 2002, p.153

nanotechnology. a gentle introduction to the next big idea, 2002, p.153

... such as anthrax Nano skin creams and suntan lotions are already on the market, and nano-enhanced tennis balls that bounce longer appeared at the 2002 Davis Cup To date, most companies that claim ... can themselves act as mechanical devices like hinges, bearings, or structural members for machines that are nanoscale For microscale and larger devices, bonds are just a means of creating materials ... such as the nanoscale abacus that we saw in Chapter It takes a great deal of enhancement just to make the raw results look as good as the ghostly x-ray pictures taken of your luggage at the airport...

Ngày tải lên: 04/06/2014, 15:19

153 551 0
3d computer graphics - a mathematical introduction with opengl

3d computer graphics - a mathematical introduction with opengl

... spheres, planes, triangles, polytopes, and other surfaces and addresses bounding volumes and hierarchical pruning Chapter XI Radiosity Presents patches, form factors, and the radiosity equation; ... Representation of Affine Transformations Recall that any affine transformation A can be expressed as a linear transformation B followed by a translation Tu , that is, A = Tu ◦ B Let M be a × matrix ... project files are available The software includes several small OpenGL programs and a relatively large ray tracing software package The software may be used without any restriction except that its...

Ngày tải lên: 28/04/2014, 15:47

397 347 0
A simple introduction to working with LVM

A simple introduction to working with LVM

... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... still suggest doing it offline as that is less scary.) Looking at lvdisplay again we can see the volume was resized: root@lappy:~# lvdisplay - Logical volume LV Name /dev/skx-vol/test VG Name skx-vg...

Ngày tải lên: 18/09/2012, 10:12

7 675 0
Mobile 3D Graphics with OpenGL ES and M3G

Mobile 3D Graphics with OpenGL ES and M3G

... non-sequential ways That is, a call to ArrayElement that precedes a change to array data may access the changed data, and a call that follows a change to array data may access original data Specifying ... floatingpoint The final character, if present, is v, indicating that the command takes a pointer to an array (a vector) of values rather than a series of individual arguments Two specific examples ... triangles are the same as a triangle strip The rules given for polygons also apply to each triangle generated from a triangle strip, triangle fan or from separate triangles Quadrilateral (quad)...

Ngày tải lên: 03/11/2012, 11:23

333 520 2
iPhone OpenGL ES

iPhone OpenGL ES

... Todayʼs Agenda OpenGL Graphics Theory OpenGL ES Tutorial iPhone OpenGL ES Resources Questions OpenGL OpenGL Open Graphics Library Cross platform API for creating 2D/3D graphics Standard API that ... In OpenGL a vertex is the term used to define a point A Vertex is usually a corner point of a triangle Triangles Area defined by vertices - smallest amount of data required to create a surface Basic ... glEnable(GL_CULL_FACE); • OpenGL Iterates though the vertex array and draws to the buffer in order, triangles later in the buffer are drawn over top of triangles earlier • Typically 3D objects are closed surfaces...

Ngày tải lên: 03/11/2012, 11:30

51 478 3
A General Introduction to Hegel_s system

A General Introduction to Hegel_s system

... these realities are; that had already been done, and was in fact an obvious commonplace in philosophy The most general and distinct finite realities are Nature and Mind He takes these as palpably ... world of passion and pain.13 For God’s exaltation above man did not affect man’s ability to know him; it was a moral and metaphysical exaltation, not an elevation beyond the range of man’s knowledge; ... of explanation in religion, and found in it all that was characteristic of reason,—unity, and harmony of opposites Love, in fact, was the “analogue” of reason.7 “Life,” again, was treated as the...

Ngày tải lên: 06/11/2012, 15:51

252 519 0
A Group Introduction Activity to Create a Safe Atmosphere

A Group Introduction Activity to Create a Safe Atmosphere

... campus She has a roommate from Canada, and is happy to have a chance to practice English on a daily basis There are four in her family: herself, her father, mother and older sister, who's graduating ... introductions Each activity is designed to create a safe atmosphere, in which each student has a stake in the successful completion of each oral assignment It is important to me as a teacher that the class ... the group formation you may have each group offer 10 categories each and write them on the blackboard The class can as a whole then choose which 10, 15 or 20 questions/categories they would most...

Ngày tải lên: 06/09/2013, 10:10

4 381 0
A tutorial introduction

A tutorial introduction

... to these local variables (Chapter discusses the static storage class, in which local variables retain their values between calls.) Because automatic variables come and go with function invocation, ... define variables that are external to all functions, that is, variables that can be accessed by name by any function (This mechanism is rather like Fortran COMMON or Pascal variables declared in ... in sight an extern variable because it appears to simplify communications - argument lists are short and variables are always there when you want them But external variables are always there...

Ngày tải lên: 30/09/2013, 06:20

26 481 0
A “gentle discipline” - Spenser’s Faerie Queene

A “gentle discipline” - Spenser’s Faerie Queene

... regalitie, / And makes it seruant to her basest part” (2.1.57) While “reason” should rule with “due regalitie,” intemperate despair makes Amavia a servant to “her basest part,” a phrase that ... simultaneously encodes tendencies that militate against these virtues: feudal nostalgia, freedom, play, sexual pleasure, and the fantasy of the sprezzatura “menage” of conflicting values And just as ... immediate needs, Guyon’s “base regardes”; and, paradoxically, “impoverishing” because these desires not actually satisfy but make the desirer all the more needy That Acrasia’s beastly lovers are described...

Ngày tải lên: 01/11/2013, 08:20

40 357 0
Tài liệu Computational Biology & Bioinformatics: A Gentle Overview ppt

Tài liệu Computational Biology & Bioinformatics: A Gentle Overview ppt

... GTCCTGATAAGTCAGTGTCTCC TGAGTCTAGCTTCTGTCCATGCT GATCATGTCCATGTTCTAGTCAT GATAGTTGATTCTAGTGTCCTG (b) RNA Data (4 letter strings) ACAGAGGAGAGCUAGCUUCAG GCUAGCACGCCUAGUAAGCGCU GCAGUAAGUAGUUAGCCUGCUG AGUCAGGCUGAGUUCAAGCUAG ... Laboratory DNA database (EMBL), GenBank at National Center for Biotechnology information, Bethesda and DNA Data Bank Japan (DDBJ), and Protein databases at SWISS-PROT (Protein sequence database at ... UCCUGAU AAGUCAG UGUCUCCU GAGUCUA GCUUCUG UCCAUGC UGAUCAU GUCCAUG UUCUAGU CAUGAUA GUUGAUUC UAGUGUCC UGAUUAG CCUUGA AUCUUCU AGUUCU GUCCAU UAUCCAU There are different kinds of RNA and biologists have...

Ngày tải lên: 13/12/2013, 00:15

13 363 1
Tài liệu A Concise Introduction to Data Compression- P1 pdf

Tài liệu A Concise Introduction to Data Compression- P1 pdf

... may appear many times, and in an audio file, a string of audio samples may also appear repeatedly A dictionary-based method maintains a dictionary that contains bits and pieces of the data As a ... data The following are the main considerations that apply to this technique: Text in a natural language (as well as names) may have many doubles and a few triples—as in AAA (an acronym), abbess, ... yells A| AAAAAAAAAAAAAAAH The encoder creates the token (1,9 ,A) , matching the first nine copies of A in the lookahead buffer and including the tenth A This is why, in principle, the length of a match...

Ngày tải lên: 14/12/2013, 15:15

50 433 0
Tài liệu A Concise Introduction to Data Compression- P2 ppt

Tài liệu A Concise Introduction to Data Compression- P2 ppt

... 1|000 a2 a1 a1 1|001 a2 a1 1|010 a2 a2 1|011 a2 1|100 a5 1|101 a4 1|110 a3 a1 1|111 a3 0 T2 11|000 11|001 11|010 11|011 11|100 11|101 11|110 11|111 = 11 a5 a1 a5 a4 a1 a4 a3 a1 a1 a3 a1 a3 a2 a3 ... a1 2345 a1 0.4 a1 45 0.6 a2 345 a2 0.2 a4 0.1 a2 0.2 a3 0.2 a3 45 a2 3 1.0 0.4 0.4 a4 0.1 a4 5 a5 0.1 0.6 a3 0.2 1 a4 5 0.2 a5 0.1 (a) 0.2 (b) Figure 2.1: Huffman Codes smallest variance The variance of a ... 110|000 a5 a1 a1 110|001 a5 a1 110|010 a5 a2 110|011 a5 110|100 a4 a1 a1 110|101 a4 a1 110|110 a4 a2 110|111 a4 2 Table 2.7: Partial-Decoding Tables for a Huffman Code Notice that some chunks (such as...

Ngày tải lên: 14/12/2013, 15:15

50 453 0
Tài liệu A Concise Introduction to Data Compression- P3 pptx

Tài liệu A Concise Introduction to Data Compression- P3 pptx

... counts Table 4.13b shows the same symbols sorted by count (a) (b) a1 11 a8 19 a2 12 a2 12 a3 12 a3 12 a4 a9 12 a5 a1 11 a6 a7 a8 a9 a1 0 19 12 a1 0 a5 a4 a7 a6 2 Table 4.13: A Ten-Symbol Alphabet ... say, 1, 5, and The encoder outputs the three raw symbols b, b, and a, moves the separator, and updates the hash table as follows: abba|abbaabaabaaaa 0 1234 5678901234567 Next, the triplet abb ... tree after the swap Notice how the left-subtree counts have been updated (a) (b) a8 19 40 a8 19 41 a2 12 16 a9 13 16 a3 12 a3 12 a9 12 a2 12 a1 11 a1 11 a1 0 a1 0 a5 a5 a4 a4 a7 a7 a6 a6 Table...

Ngày tải lên: 14/12/2013, 15:15

50 466 0
Tài liệu A Concise Introduction to Data Compression- P4 pptx

Tài liệu A Concise Introduction to Data Compression- P4 pptx

... differences feature additional properties The averages are a coarse representation of the original values and the differences are small We repeat the process on the four averages and transform ... terms “difference” and “detail” are used interchangeably We can think of the averages as a coarse resolution representation of the original values, and of the details as the extra data needed to reconstruct ... 5.51 lists a Matlab program that inputs a grayscale image (in raw format, just rows of pixel values), computes its Haar wavelet transform, discards a given percentage of the smallest transform coefficients,...

Ngày tải lên: 14/12/2013, 15:15

50 474 0
Tài liệu A Concise Introduction to Data Compression- P5 docx

Tài liệu A Concise Introduction to Data Compression- P5 docx

... —Tom Clancy, Clear and Present Danger Chapter Summary Images are an important type of digital multimedia data Images are popular, they are easy to create (by a digital camera, scanning a document, ... redundancy in digital audio is the fact that adjacent audio samples tend to be similar; they are correlated With 44,100 samples each second, it is no wonder that adjacent samples are virtually always ... the audio samples Consecutive audio samples may become larger and larger and be followed by smaller and smaller samples It therefore makes sense to assume that an audio sample is related in a simple...

Ngày tải lên: 14/12/2013, 15:15

50 447 0
w