online fault diagnosis during startup of a lab scale distillation column

... approach of using the magnitude or range of variation of the variable as a measure of its importance is not a robust indicator of a variable’s importance Some variables like the temperature of ... operation in the Tennessee Eastman challenge process, a lab- scale fed-batch fermentation process, and a lab- scale distillation column Their performance are compared with traditional methods and ... computational cost, which makes it amenable for large -scale case studies In Chapter 4, a new signal comparison-based approach, called dynamic locus analysis (DLA), for online state identification and...

Ngày tải lên: 30/09/2015, 06:40

... created maps containing as many as 518 million of these hyperlinks, a significant sample of the total These maps allow rapid calculation of a web page’s "PageRank", an objective measure of its citation ... PageRank, again see [Page 98] Another intuitive justification is that a page can have a high PageRank if there are many pages that point to it, or if there are some pages that point to it and have ... the academic realm Appendix B: Scalability Scalability of Google We have designed Google to be scalable in the near term to a goal of 100 million web pages We have just received disk and machines...

Ngày tải lên: 24/01/2014, 20:20

... Zhuang, Ben Y Zhao, Anthony D Joseph, Randy H Katz, and John Kubiatowicz Bayeux: An Architecture for Scalable and Fault- tolerant Wide-Area Data Dissemination In Proc of the Eleventh International ... decisions are based on local information, and each node has identical capabilities Each node can act as a publisher, a root of a multicast tree, a subscriber to a topic, a node within a multicast tree, ... Internet applications In Proc ACM SIGCOMM’01, San Diego, CA, August 2001 15 S Ratnasamy, P Francis, M Handley, R Karp, and S Shenker A Scalable ContentAddressable Network In Proc of ACM SIGCOMM, August...

Ngày tải lên: 19/02/2014, 18:20

... Leiomyosarcoma Melanoma Ovarian carcinoma Ovarian sarcoma Pancreatic cancer Pharyngeal cancer Plasmocytoma Pleural mesotelioma Prostatic cancer Rectum carcinoma Thymic carcinoma Thyroid carcinoma Tonsillar ... disease Table shows the demographic, table the clinical and treatment characteristics of the participants Participants with malignancies had a broad range of tumour localisations (table 3) At the ... Puhlemann and Lisa Arndt for recruitment of participants and Dagmar Brauer for the database documentation and lecture MK, RZ, DB Page 10 of 11 (page number not for citation purposes) Health and Quality...

Ngày tải lên: 18/06/2014, 18:20

... Preparation of the paper; analyses and interpretation of data; final approval of the version to be published MS: Preparation of the paper; analyses and interpretation of data; final approval of ... Preparation of the paper; acquisition of subjects and data; final approval of the version to be published NS: Preparation of the paper; analyses and interpretation of data; final approval of the ... Validation of the Self-Management Ability Scale (SMAS) and development and validation of a shorter scale (SMAS-S) among older patients shortly after hospitalisation Jane M Cramm*, Mathilde...

Ngày tải lên: 20/06/2014, 16:20

... is the farad; farad = coulomb per volt; typical capacitances are measured in microfarads or picofarads) 5.2.1 The Virtual Capacitor To implement the law of Coulomb, a TinyOS application was developed ... 3B37 3A2 8 3B49 3B50 3A2 6 3B53 3A2 7 Controller 3A3 1 3A2 2 3A2 3 3A1 4 3A1 1 3A1 9 3B51 3B54 3A2 0 3A7 3B35 3B38 3A4 3A1 3A1 0 3A1 5 3A8 3A1 6 3B42 3B46 3A2 1 3A1 8 3A9 3A2 3A6 3A3 Figure 12: Spatial distribution ... know that the capacitance (stated in terms of the amount of charge (Q) stored at a given voltage drop (across the capacitor)) of a capacitor is given by (1) (Note that: the SI unit of capacitance...

Ngày tải lên: 21/06/2014, 11:20

... ALGORITHM Statistical analysis of microarray data can essentially process massive amounts of data and can also adjust for various sources of variability in order to identify the important genes ... image analysis on cDNA microarray data,” Journal of Computational and Graphical Statistics, vol 11, no 1, pp 108–136, 2002 G Kornaros, et al., “Architecture of a consumer lab- onchip for pharmacogenomics,” ... SYSTEM-ON-CHIP ARCHITECTURE FOR MICROARRAY DATA ANALYSIS We describe and evaluate in detail the two alternative architectures of the single-core and multicore approach Also, the details for the data analysis...

Ngày tải lên: 21/06/2014, 22:20

... cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial imaging has the advantage of the central and peripheral areas ... suspected area was resected The final confirmation of ELCs was based on the pathology reports Axial and coronal HRCT protocol Data analysis The imaging parameters were as follows: 1.0 mm collimation, ... Hazama Kenji, Akashi Akinori, Shigemura Norihisa, Nakagiri Tomoyuki: Less invasive needle thoracoscopic laser ablation of small bullae for primary spontaneous pneumothorax Eur Jour Cardio-thoracic...

Ngày tải lên: 10/08/2014, 09:21

... clinical research standards Task Force of the Medical Scientific Advisory Board of the Myasthenia Gravis Foundation of America Neurology 2000, 55(1):16-23 Masaoka A, Monden Y, Nakahara K, Tanioka ... clinical classification of the Medical Scientific Advisory Board of the Myasthenia Gravis Foundation of America (MGFA) [3] The patient was classified to be in MGFA class IIa, as mild weakness ... in myasthenia gravis: comparative analysis of the effect of thymoma J Thorac Cardiovasc Surg 2007, 134(3):601-7 Mirsadraee S, Shah SS, Kumar B, Kaul P: Incidental locally infiltrating malignant...

Ngày tải lên: 10/08/2014, 10:20

... Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser1, Martin Koskas1, Francine Walker2, Dominique Luton1 and Chadi Yazbeck1,3* ... developing immature teratoma during ovarian stimulation Immature teratomas are usually derived from a malignant transformation of mature teratomas [3, 4] The amount of neuroectodermal immature tissue present ... teratoma in such a situation Clinical and ultrasound arguments for this immature form are scarcely or poorly evaluated Case Presentation: We describe the case of a 31-year-old Caucasian woman...

Ngày tải lên: 10/08/2014, 22:20

... Intensive care unit The ICU, consisting of 25 critical care beds, is part of a specialist hospital that concentrates on all aspects of adult cardiothoracic care Approximately 70% of admissions are patients ... detailed data on particular aspects of a patient's condition and treatment – are accessible via tabs displayed across the top of the summary screen as shown in Figure A multidisciplinary team at ... place of a paper record? Given the complex nature of interaction of multidisciplinary communication in an ICU, we have chosen to triangulate three types of qualitative data: video-based interaction...

Ngày tải lên: 25/10/2012, 10:31

... radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory -scale and pilot-plant scale reactors, and even ... Hakoda M., Shimbara S., Nagaoka H., Chung Y and Hamada A (1994) Active oxygen species generated during chlorination and ozonation Water Sci Technol., 30, 91-99 Utsumi H., Han S.K and Ichikawa ... Japan, and by the grant from Takeda Science Foundation REFERENCES Andreozzi R., Caprio V., Insola A and Marotta R (1999) Advanced oxidation processes (AOP) for water purification and recovery Catal...

Ngày tải lên: 05/09/2013, 09:38

... Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[enter] Delete flash:vlan.dat? [confirm] [enter] If there was no VLAN file, this message is displayed %Error deleting flash:vlan.dat (No such ... Configuration lab Step Configure the host attached to the switch Configure the host to use the same IP subnet for the address, mask, and default gateway as on the switch Step Verify connectivity a ... exit, and turn all the devices off Then remove and store the cables and adapter 3-4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6.2.9 Copyright  2003, Cisco Systems, Inc Erasing...

Ngày tải lên: 16/10/2013, 21:15

... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 Copyright...

Ngày tải lên: 21/12/2013, 19:15

... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 Copyright...

Ngày tải lên: 18/01/2014, 04:20

... switch startup configuration from NVRAM #delete nvram This command resets the switch with factory defaults All system parameters will revert to their default factory settings All static and dynamic ... Inc Erasing and Reloading the Switch For the majority of the labs in CCNA and CCNA it is necessary to start with an unconfigured switch Use of a switch with an existing configuration may produce ... enable If prompted for a password, enter class (if that does not work, ask the instructor) Switch>enable Remove the VLAN database information file Switch#delete flash:vlan.dat Delete filename...

Ngày tải lên: 24/01/2014, 19:20

... might stay and be jammed I found afterward that this individual was troubled with a kind of insanity peculiar to all headquarters, arising out of an exaggerated idea of his own importance I had the ... that I shall hear of him again as the proprietor of an overland mail, or the patron and capitalist of Greenland emigration I passed the second and third days quietly in camp, writing a couple of ... horse, a deep challenge came directly from the thicket, and I saw the flash of a sabre, as I stammered a reply Led to a cabin close at hand, my pass was examined by candle-light, and I learned that...

Ngày tải lên: 07/03/2014, 01:20

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...

Ngày tải lên: 08/03/2014, 10:20

... to an LSWTF are available that could potentially provide much of the same data A variety of tools for research on wind-resistant structures are available, including analysis, numerical computation, ... Engineering Institute of Canada; Golden Plate Award, American Academy of Achievement; International Award of Merit in Structural Engineering, International Association of Bridge and Structural Engineering; ... http://www.nap.edu/catalog/6458.html ACRONYMS 40 Acronyms DOE U.S Department of Energy FEMA Federal Emergency Management Agency INEEL Idaho National Engineering and Environmental Laboratory NASA National Aeronautics and Space Administration...

Ngày tải lên: 08/03/2014, 19:20

... N A 0a 0a N A N A 58 4 9a 2 8a a Methylmalonyl-CoA Malonyl-CoA Propionyl-CoA; methylmalonyl-CoA; NADPH Butyryl-CoA; methylmalonyl-CoA; NADPH Valeryl–CoA; methylmalonyl-CoA; NADPH Propionyl-CoA; ... quaternary structure A similar inhibition of loading of methylmalonate onto an ACP was also reported in a study of the epothilone synthase, and again the effect was attributed to the quaternary ... spheres of appropriate size These domains are sited away from the axis of the proposed structure to free up a central passage The pair of ACP domains can now make contact with the pair of KS domains...

Ngày tải lên: 16/03/2014, 03:20