on the flip of a coin the streets traduction

What is the price of a mousetrap? The assessment of value from cloud services pptx

What is the price of a mousetrap? The assessment of value from cloud services pptx

... solution. The latter has the additional attributes of being available anywhere, at anytime and on any device. If it was only a simple as a mouse-trap. The complication is that for most customers they ... corporation Conclusion In this ebook, I discuss one functional transformation that has taken placed as a result of cloud services, namely; the impact on the assessment of value. This is a timely ... extrapolation of demand, based upon exponential or other disruptive consumption rates? The figure below displays mobile phone subscriptions as just one example of the exponential and tectonic forces...

Ngày tải lên: 09/03/2014, 02:20

3 508 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* ... calibration standards provided by the manu- facturer. Data processing was performed using the deconvo- lution module of the data analysis software to detect the multiple charge states and obtain ... maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIM sequences from various sources facilitate an analysis of mutational...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
a systematic review of the research literature on the use of phonics in the teaching of reading and spelling

a systematic review of the research literature on the use of phonics in the teaching of reading and spelling

... as calculated by the reviewers (mean of word recognition and word attack measures; also mean of comprehension measures, mean of spelling measures, and synthetic versus analytic, where applicable), ... reading accuracy (reading comprehension; spelling) Effect size, as calculated by the reviewers (mean of word recognition and word attack measures; also mean of comprehension measures, mean ...  Table 1: Characteristics of the included RCTs, cont. Author, date Study design Participants Intervention/control Sample size Outcome measures used in calculation of effect sizes by the...

Ngày tải lên: 02/06/2014, 09:22

85 571 0
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

... schools, and health professionals, and this is particularly accentuated by the Western diet which is particularly heavy on foods that contain products containing wheat, rye and barley (Mearin, ... editorials, letters, conference abstracts). Data extraction In order to ease extraction of information from papers, a data extraction form was used to note important study criteria (Appendix ... by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis. As such, a score of 0 denotes no available evidence...

Ngày tải lên: 12/02/2014, 12:20

171 709 0
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

... contained in his treatise. The longest of the additions belongs to the chapter on Causation, and is a discussion of the question how far, if at all, the ordinary mode of stating the law of Cause ... improvement) can only consist in performing more systematically and accurately man, a Greek, an Athenian, a sculptor, an old man, an honest man, a brave man. All these are, or may be, names of Sophroniscus, ... example, of applying the expression “abstract name” to all names which are the result of abstraction or generalization, and consequently to all general names, instead of confining it to the names of...

Ngày tải lên: 06/03/2014, 13:20

1K 548 0
On the uncertainty of the signs of murder in the case of bastard children doc

On the uncertainty of the signs of murder in the case of bastard children doc

... called murders of bastard children, are of a very different kind. The mother has an unconquerable sense of shame, and pants after the preservation of character: so far she is virtuous and amiable. ... 596-1887, email business@pglaf.org. Email contact links and up to date contact information can be found at the Foundation's web site and official page at http://pglaf.org For additional contact ... the direction of a calm and unembarrassed mind; but the moment we reflect that her mind was violently agitated with a conflict of passions and terror, an irrational conduct may appear very natural. Allow...

Ngày tải lên: 23/03/2014, 02:20

13 419 0
MUTUAL BANKING: SHOWING THE RADICAL DEFICIENCY OF THE PRESENT CIRCULATING MEDIUM, AND THE ADVANTAGES OF A FREE CURRENCY docx

MUTUAL BANKING: SHOWING THE RADICAL DEFICIENCY OF THE PRESENT CIRCULATING MEDIUM, AND THE ADVANTAGES OF A FREE CURRENCY docx

... and thus puts a drag on all production. There are various Kinds of Money. But all money is not the same money. There is one money of gold, another of silver, another of brass, another of leather, ... and therefore may serve as a standard of length; silver has actual intrinsic value, and may therefore serve as a standard of value: but the bill of a Mutual Bank, having a legal value only, and ... standards or measures of value; and this fact is put forth as a recommendation of the mutual money to favorable consideration. The SILVER DOLLAR is the measure and standard of value ; and the...

Ngày tải lên: 29/03/2014, 08:20

46 327 0
Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx

Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx

... to the needs of the ma rket, which in turn will aid in assessing the translational potential of ideas that are still in the percolation phase. The NIH intramural program is an ideal test site ... principal investigator in the NIH intramural program. The article was written in his personal capacity and the views do not represent those of the Department of Health and Human Services, National ... problem or that. A translational Correspondence: mikeeb@atlanticbb.net Maryland, USA Emmert-Buck Journal of Translational Medicine 2011, 9:54 http://www.translational-medicine.com/content/9/1/54 â...

Ngày tải lên: 18/06/2014, 19:20

4 395 0
báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt

báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt

... feature of the percubator, particularly in light of today’ susual translational approach: a) academia hands off an appli- cation to the private sector only if and when i t meets a threshold of projected ... the success of a transla- tional endeavor then shifts to the motivation of the Emmert-Buck Journal of Translational Medicine 2011, 9:54 http://www.translational-medicine.com/content/9/1/54 Page ... to incubator and then back to the drawing board (percola- tor) again to solve this problem or that. A translational Correspondence: mikeeb@atlanticbb.net Maryland, USA Emmert-Buck Journal of Translational...

Ngày tải lên: 20/06/2014, 03:20

4 417 0
Báo cáo hóa học: " Research Article On the Exponent of Convergence for the Zeros of the Solutions of y Ay By 0" pdf

Báo cáo hóa học: " Research Article On the Exponent of Convergence for the Zeros of the Solutions of y Ay By 0" pdf

... linear differential equations,” Journal of Mathematical Analysis and Applications, vol. 342, no. 1, pp. 39–51, 2008. 9 W. K. Hayman, On the characteristic of functions meromorphic in the plane ... h   A, arises if conclusion i of Lemma 4.4 holds, and t he proof of the theorem is complete. Acknowledgment The author thanks Professor J. K. Langley for the invaluable discussions on the results ... Zeros of the Solutions of y   Ay   By  0 Abdullah Alotaibi Department of Mathematics, King Abdulaziz University, P.O. Box 80203, Jeddah 21589, Saudi Arabia Correspondence should be addressed...

Ngày tải lên: 21/06/2014, 07:20

8 452 0
The Making of a Consultant The Keys to Establishing a Successful Consulting Career potx

The Making of a Consultant The Keys to Establishing a Successful Consulting Career potx

... educational qualifications: Sailing through college and graduating as an average student is not solid enough a foundation on which to launch a consulting career. Your qualifications serve as an ... compensate for low grades in college. In the corporate sector most consultants have at least a Masters in Business Administration (MBA). Apart from attaining a tertiary qualification, the process ... on the non-profit sector because of the author’s experience working for regional and international non-governmental organizations (NGOs). Furthermore, the work being done by non-profit organizations...

Ngày tải lên: 27/06/2014, 23:20

12 441 0
Research report: "To study the effect of substituents on the properties of aniline by the method of approximate quantum AM1" pps

Research report: "To study the effect of substituents on the properties of aniline by the method of approximate quantum AM1" pps

... [1-5]. On the basis of resonance theory, electron - withdrawing constituents, especially at the para position, should favor quinoid resonance structures, which are more planar than aniline ... accompanying loss of electron density from the amino nitrogen atom decreases the pKa of the amino group. Conversely, electron-donating substituents favor pyramidal sp 3 hybridization at the amino nitrogen, ... =0.6225). The para substituents have a greater effect on the C-N bond length (angle factor =-0.0229) than do the meta substituents( angle factor =-0.0071). The correlation between Q N and Hammett...

Ngày tải lên: 23/07/2014, 13:21

6 375 0
Báo cáo khoa học: "Surgical removal of stones in the stomach of a tiger shovelnose catfish" potx

Báo cáo khoa học: "Surgical removal of stones in the stomach of a tiger shovelnose catfish" potx

... and increasing immune function [2,4]. Anesthesia was induced in large vat of water. Isoflurane was used at a rate of 2.5 ml in one gallon of water [1,3]. After induction, the patient was weighed ... anesthesia was also used in maintaining anesthesia with diluting to one ml isoflurane per gallon of water with isoflurane and was pumped up from the vat to the fishs oral cavity, over the gills and backed ... infection. Postoperative care and evaluation The patient was monitored postoperatively for awakening from anesthesia, and gastrointestinal track function with patients motion (activity, respiration,...

Ngày tải lên: 07/08/2014, 18:20

3 403 0
Báo cáo toán học: "A conjecture of Biggs concerning the resistance of a distance-regular graph" potx

Báo cáo toán học: "A conjecture of Biggs concerning the resistance of a distance-regular graph" potx

... between any two vertices of G can be calculated explicitly using only the intersection array, so that the proof can be conducted using only the known properties of the array. 3 Electric resistance on ... discussions between the two authors as to whether Theorem 1 really gives new information on the structure of distance-regular graphs. It can be shown that any sequence of non-increasing b i ’s and non-decreasing ... problem. A function f on V is harmonic at a point z ∈ V if f(z) is the average of neighboring values of f, that is  x∼z (f(x) − f(z)) = 0(3) The voltage function on V can be characterized as the...

Ngày tải lên: 08/08/2014, 12:22

15 199 0
w