nursing as a career

novel secondary preventative strategies in the management of ischaemic stroke and transient ischaemic attack

novel secondary preventative strategies in the management of ischaemic stroke and transient ischaemic attack

...   ASSERT:  ASymptomatic  atrial  fibrillation  and  Stroke  Evaluation  in  pacemaker  patients  and  the  atrial   fibrillation  Reduction  atrial  pacing  Trial   AST:  Aspartate  transaminase ...  American  Heart  Association   AI:  Augmentation  index   AI@HR75:  Augmentation  index  standardised  for a  heart  rate  of  75  beats  per  minute   ALT:  Alanine  transaminase   AM:  Additional ... marker   of   elevated   cardiovascular   risk   attributable   to   either   its   association   with   established   cardiovascular   risk   factors   or,   alternatively,   as   a   surrogate...

Ngày tải lên: 22/12/2014, 21:59

344 370 0
Characterisation of fitness parameters and population dynamics of botrytis cinerea for the development of  fungicide resistance management strategies in grapevine

Characterisation of fitness parameters and population dynamics of botrytis cinerea for the development of fungicide resistance management strategies in grapevine

... β-tubulin GGAGCAACAATTAATCGCATTTC SUAREZ et al (2005) CACGGCTACAGAAAGTTAGTCTACAA SUAREZ et al (2005) Partial sequencing of β-tubulin TUB-HPF1 β-tubulin TGTCGAGCCATATAACGCAA BANNO et al (2008) TUB-HPR1 ... β-tubulin CCAACTTTCGGAGATCTGAG BANNO et al (2008) Bc-E19 8A E19 8A GGTTGAGAACTCTGACGC LUCK et al (1995) Q-E19 8A E19 8A CAATTGGTTGAGAACTCTGACGC This study Q-E19 8A- AM E19 8A CAATTGGTTGAGAACTCTGACCC This ... genera Trichoderma, Gliocladium and Ulocladium, bacteria of the genera Bacillus and Pseudomonas, as well as various yeasts as summarized by ELAD and STEWART, 2004) However, control of B cinerea...

Ngày tải lên: 19/11/2015, 15:46

132 407 0
Corporate and Marketing Strategies in the High-Tech Industry

Corporate and Marketing Strategies in the High-Tech Industry

... Company Nose Aerospatiale Body MBB Wings British Aerospace Tail CASA Final assembly Aerospatiale because of the pressure they put on a company’s financial and managerial resources To maximize the ... some alliances are market based, a significant number are technology based Indeed, an alliance is more and more frequently also seen as a way to achieve increasing returns by constructing a technology-oriented ... instantaneously Small companies, such as emWare, a software firm, or Ubicom, a chips manufacturer, as well as large firms, such as IBM or Accenture are working hard on those technologies and consider it as...

Ngày tải lên: 24/10/2013, 07:20

42 685 1
Tài liệu The Healthy School Communities Model Aligning Health & Education in the School Setting pdf

Tài liệu The Healthy School Communities Model Aligning Health & Education in the School Setting pdf

... coordinated school health approach has undoubtedly had some success For example, it has been adopted by 46 states in the United States and has been adapted for Mexico, Canada, Egypt, Saudi Arabia, ... community health and educational psychology from the University of Illinois at Urbana-Champaign; and a Master of Public Health degree in health behavior from the University of Alabama at Birmingham Medical ... Similar calls for greater alignment have made increasingly more noise over the past decade In 1998, Eva Marx, Susan Wooley, and Daphne Northrop stated in their pivotal publication, Health Is Academic,...

Ngày tải lên: 14/02/2014, 09:20

64 510 0
Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern Massachusetts pptx

Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern Massachusetts pptx

... the Assabet River Basin, Eastern MA Table Drainage-area characteristics and mean annual flows at streamflow-gaging stations in and near the Assabet River Basin, eastern Massachusetts [Period of ... Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern MA Table Permitted water-supply withdrawals and wastewater discharges in the Assabet River Basin, eastern ... withdrawals and wastewater discharges in the Assabet River Basin, eastern Massachusetts 29 Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern...

Ngày tải lên: 17/03/2014, 15:20

142 1,4K 0
báo cáo hóa học: " Aging and selective sensorimotor strategies in the regulation of upright balance" docx

báo cáo hóa học: " Aging and selective sensorimotor strategies in the regulation of upright balance" docx

... before and after VE exposure and perturbation trials Data analysis A biomechanical model (Plug-In Gait) was used in conjunction with kinematic data and anthropometric measures to calculate the ... offline analysis Functional balance and mobility in terms of gait velocity, ability to maintain tandem stance, timed repeated sit-to-stand, as described in a physical performance battery [23] were assessed ... Muscle latencies were determined as the first burst that exceeded a threshold of two standard deviations above the background mean level and lasting at least 50 ms, with an activation probability...

Ngày tải lên: 19/06/2014, 10:20

7 396 0
Monetary policy strategies in the world economy carlberg_3 potx

Monetary policy strategies in the world economy carlberg_3 potx

... European money supply or American money supply An increase in A causes an increase in both European money supply and American money supply A unit increase in A causes an increase in European money ... American money supply As a result there is a unique Nash equilibrium According to equations (11) and (12), an increase in A1 causes an increase in both European money supply and American money ... the American central bank at zero units 62 Monetary Interaction between Europe and America: Case A Table 3.2 Monetary Interaction between Europe and America A Supply Shock in Europe Europe America...

Ngày tải lên: 20/06/2014, 20:20

31 284 0
Monetary policy strategies in the world economy carlberg_4 pptx

Monetary policy strategies in the world economy carlberg_4 pptx

... An increase in A1 causes an increase in European government purchases and a decline in American government purchases A unit increase in A1 causes an increase in European government purchases of ... Nash equilibrium According to equations (7) and (8), an increase in A1 causes an increase in European government purchases and a decline in American government purchases A unit increase in A1 ... (14), an increase in A1 The Model 121 causes an increase in European government purchases and a decline in American government purchases A unit increase in A1 causes an increase in European government...

Ngày tải lên: 20/06/2014, 20:20

31 327 0
Monetary policy strategies in the world economy carlberg_5 doc

Monetary policy strategies in the world economy carlberg_5 doc

... there is a unique cooperative equilibrium An increase in A1 causes an increase in both European government purchases and American government purchases A unit increase in A1 causes an increase in ... effects on America and vice versa An increase in European government purchases lowers American unemployment and raises American inflation Similarly, an increase in American government purchases lowers ... Europe has spillover effects on America and vice versa An increase in European money supply raises American unemployment and lowers American inflation Similarly, an increase in American money...

Ngày tải lên: 20/06/2014, 20:20

31 281 0
Monetary policy strategies in the world economy carlberg_8 docx

Monetary policy strategies in the world economy carlberg_8 docx

... purchases A unit increase in A1 causes an increase in European money supply of 0.67 units and an increase in American money supply of 0.33 units As a result, monetary and fiscal cooperation can ... and American government purchases As a result there is a unique Nash equilibrium An increase in A1 causes an increase in European money supply, an increase in American money supply, no change in ... cooperative equilibrium An increase in A1 causes an increase in European money supply, an increase in American money supply, no change in European government purchases, and no change in American...

Ngày tải lên: 20/06/2014, 20:20

31 315 0
Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_1 ppt

Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_1 ppt

... supply and government purchases As a result there is a unique Nash equilibrium An increase in A causes a decline in money supply and an increase in government purchases And the same applies to an ... cooperative equilibrium of money supply and government purchases As a result there is a unique cooperative equilibrium An increase in A causes an increase in money supply And an increase in B causes ... monetary policy in Europe has spillover effects on America and vice versa An increase in European money supply raises American unemployment and lowers American inflation Similarly, an increase...

Ngày tải lên: 20/06/2014, 23:20

31 329 0
Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_2 pdf

Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_2 pdf

... European money supply or American money supply An increase in A causes an increase in both European money supply and American money supply A unit increase in A causes an increase in European money ... American money supply As a result there is a unique Nash equilibrium According to equations (11) and (12), an increase in A1 causes an increase in both European money supply and American money ... the American central bank at zero units 62 Monetary Interaction between Europe and America: Case A Table 3.2 Monetary Interaction between Europe and America A Supply Shock in Europe Europe America...

Ngày tải lên: 20/06/2014, 23:20

31 358 0
Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_4 ppt

Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_4 ppt

... there is a unique cooperative equilibrium An increase in A1 causes an increase in both European government purchases and American government purchases A unit increase in A1 causes an increase in ... effects on America and vice versa An increase in European government purchases lowers American unemployment and raises American inflation Similarly, an increase in American government purchases lowers ... Europe has spillover effects on America and vice versa An increase in European money supply raises American unemployment and lowers American inflation Similarly, an increase in American money...

Ngày tải lên: 20/06/2014, 23:20

31 338 0
Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_6 pdf

Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_6 pdf

... purchases, and American government purchases As a result there is a unique Nash equilibrium An increase in A1 causes a decline in European money supply, a decline in Some Numerical Examples 189 American ... function We assume that the American central bank has a quadratic loss function: LM = π2 + u 2 (8) LM is the loss to the American central bank caused by inflation and unemployment in America We assume ... of European money supply, American money supply, European government purchases, and American government purchases As a result there is a unique Nash equilibrium An increase in A1 causes a decline...

Ngày tải lên: 20/06/2014, 23:20

31 401 0
Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_7 pot

Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_7 pot

... purchases A unit increase in A1 causes an increase in European money supply of 0.67 units and an increase in American money supply of 0.33 units As a result, monetary and fiscal cooperation can ... and American government purchases As a result there is a unique Nash equilibrium An increase in A1 causes an increase in European money supply, an increase in American money supply, no change in ... cooperative equilibrium An increase in A1 causes an increase in European money supply, an increase in American money supply, no change in European government purchases, and no change in American...

Ngày tải lên: 20/06/2014, 23:20

31 305 0
Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_8 doc

Monetary and Fiscal Strategies in the World Economy by Michael Carlberg_8 doc

... American central bank is American money supply We assume that the American central bank has a quadratic loss function The amount of loss depends on inflation and unemployment in America The American ... central bank is American money supply We assume that the American central bank has a quadratic loss function The amount of loss depends on inflation and unemployment in America The American central ... vice versa An increase in European government purchases lowers American unemployment and raises American inflation Similarly, an increase in American government purchases lowers European unemployment...

Ngày tải lên: 20/06/2014, 23:20

31 319 0
Báo cáo khoa học nông nghiệp " A PRELIMINARY EVALUATION OF ADOPTION AND IMPLEMENTATION OF BETTER MANAGEMENT PRACTICES IN THE CATFISH FARMING INDUSTRY IN THE MEKONG DELTA, VIETNAM " ppt

Báo cáo khoa học nông nghiệp " A PRELIMINARY EVALUATION OF ADOPTION AND IMPLEMENTATION OF BETTER MANAGEMENT PRACTICES IN THE CATFISH FARMING INDUSTRY IN THE MEKONG DELTA, VIETNAM " ppt

... to emerge Data was then subject to qualitative and semi-quantitative analysis as appropriate This approach complements the intricate and unique nature of each farmer’s reaction, and allows for ... GlobalGAP accreditation, which the provincial government was going to provide a grant to obtain • A farmer said he saw BMPs as a bottom-up first approach for farmers, whereas GlobalGAP is a top ... (Thuan Hung Company) Dai Thanh commune, Nga Bay ward, Hau Giang province ha); 05 rearing ponds with total areas of about 0.7 Aquatic Processing plant, having farms for grow out with total areas...

Ngày tải lên: 21/06/2014, 04:20

36 415 0
FW: Monetary and Fiscal Strategies in the World Economy_2 pptx

FW: Monetary and Fiscal Strategies in the World Economy_2 pptx

... European money supply or American money supply An increase in A causes an increase in both European money supply and American money supply A unit increase in A causes an increase in European money ... American money supply As a result there is a unique Nash equilibrium According to equations (11) and (12), an increase in A1 causes an increase in both European money supply and American money ... the American central bank at zero units 62 Monetary Interaction between Europe and America: Case A Table 3.2 Monetary Interaction between Europe and America A Supply Shock in Europe Europe America...

Ngày tải lên: 21/06/2014, 07:20

31 237 0
FW: Monetary and Fiscal Strategies in the World Economy_3 doc

FW: Monetary and Fiscal Strategies in the World Economy_3 doc

... An increase in A1 causes an increase in European government purchases and a decline in American government purchases A unit increase in A1 causes an increase in European government purchases of ... Nash equilibrium According to equations (7) and (8), an increase in A1 causes an increase in European government purchases and a decline in American government purchases A unit increase in A1 ... (14), an increase in A1 The Model 121 causes an increase in European government purchases and a decline in American government purchases A unit increase in A1 causes an increase in European government...

Ngày tải lên: 21/06/2014, 07:20

31 241 0
w