... (Lemuroidea) andthe lorises and galagos or bushbabies (Lorisoidea) of Africa and Asia The two groups differ systematically in a numberof anatomical details, particularly ofthe cheek teeth andthe middle ... extension ofthe bony ring (ectotym panic) around the eardrum andthe loss ofthe anterior premolar Nevertheless, there are a few candidate synapomorphies ofthe New World monkeys, mainly in details of ... Together, the chapters in the first section ofthe book clearly endorse the notion that under standing the neurobiology of primate behavior and cognition will profit from an evolutionary and...
... Reducing the health consequences of smoking: 25 years of progress; a report ofthe Surgeon General Rockville, MD: U.S Department of Health and Human Services, CDC, Office of Smoking and Health; ... Thenumberof obese Medicare beneficiaries nearly doubled from 1987 to 2002, andthe spending incurred by them almost tripled.15 Overweight and obesity is also a crisis among children Thenumber ... Statistics Group; U.S Department of Commerce, Bureau of Economic Analysis; and U.S Bureau ofthe Census 11 Soni A Personal health behaviors for heart disease prevention among the U.S adult civilian...
... Reducing the health consequences of smoking: 25 years of progress; a report ofthe Surgeon General Rockville, MD: U.S Department of Health and Human Services, CDC, Office of Smoking and Health; ... Thenumberof obese Medicare beneficiaries nearly doubled from 1987 to 2002, andthe spending incurred by them almost tripled 15 Overweight and obesity is also a crisis among children Thenumber ... Statistics Group; U.S Department of Commerce, Bureau of Economic Analysis; and U.S Bureau ofthe Census 11 Soni A Personal health behaviors for heart disease prevention among the U.S adult civilian...
... the process of completing this thesis Without the support and encouragement from Dr Lam and Dr Tho, the thesis might not be possible in meeting the requirements and expectations ofthe research ... considered a particular group and therefore the results cannot be generalized to represent for the whole industry or other various types of organizations in Vietnam 1.7 STRUCTURE OFTHE STUDY The thesis ... specific situations, thenatureofthe work, thenatureof environment, and subordinates So it proposes the styles of leadership might be different in different levels in the organization Situation...
... transfers Furthermore, there are two common triggers of third-party punishment and compensation: inequality in payoffs between the third party andthe relevant reference player, and violation ofthe fairness ... andthe accompanying title of honor; andthe category thresholds themselves We broadly define the former as the publicity effect of category reporting, andthe latter as the category effect of ... between these two effects, andthe result of his empirical analysis on the prestige motive for giving may be confounded by the presence ofthe category effect Our study disentangled the impact of the...
... Model Estimation the proportion of naive types (simply the sum ofthe relevant previous lines) andthe estimate ofthe proportion of risk neutral types (again, simply the sum ofthe relevant previous ... test, we test the hypothesis whether the proportion of naive types is the same in different pairs of treatments as well as the hypothesis whether the proportion of risk neutral types is the same in ... combinations of elements) of θ 34 In B (C) the estimate of pN RA (pN RN ) is on the boundary ofthe parameter space We not compute the standard error for this estimate since the standard error...
... reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank Influent was 60L/day pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic tank The water temperature ... the laboratory of UT at 4oCstored Then, each ofthe samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the...
... that they are at the mercy ofthe MFIs and they not have any idea about the merits ofthe loan products They will have higher satisfaction and confidence if the said MFIs are supported and recognized ... for their increment at the end of each year On the other hand, lower income group running their own businesses are encouraged by MFIs to obtain loans as the capacity building ofthe enterprise and ... Pakistan, the loan size is not as per the expectation ofthe borrowers who requires the loan majorly for the inventory storage enhancement ofthe business Majority ofthe total respondents in both the...
... the profits ofthe firms producing them The increased profit will give the proprietors of these firms the financial ability, andthe motivation, to obtain additional inputs to expand output of ... violate the privacy and trust of their workers, they engage in a form of fraud They effectively ask their workers to take a lower rate of pay than they would otherwise demand, and then don’t give their ... cost, apart from the costs suffered by others, but notice that the cost suffered by one person is only a minor part ofthe total cost, andthe greater thenumberof attendees at the meetings, the...
... (2) the target's MOA; and (3) the use ofthe tools of education, marketing, and law Figure I shows the eight segments of any market that result from the combinations ofthe presence or absence of ... and accommodate the target's MOAs andthe trade-off of free choice and externalities The potential for success ofthe three sets of tools is derived from the target's assessment ofthe "risk premium" ... (1935), The Generic Natureofthe Concepts of Stimulus and Response,” Journal of General Psychology, 12, 40-65 Smith, Adam (1776), An Inquiry Into TheNatureand Causes ofthe Wealth of Nations,...
... grandmothers as the appropriate source for the intervention The grandmothers who participated in formative research developed the chitterlings cleaning method for their peers Having the grandmothers ... to do, and how it affects the desired change? ® Taken together, will the overall mix of interventions reach enough ofthe target audience often enough to have the desired impact? ® Is the overall ... workshops), and other media Promotion leads you to consider the type of media your target audience attends to, when and where they will attend to your messages, andthe characteristics ofthe communication...
... sulphide and ammonia The heavy aeration in this method for shrimp farming further increases the amount of sludge and thereby the amount of organic material on the bottom ofthe pond through erosion The ... recirculation ofthe pond water andthe use of treatment ponds, which decrease the amount of organic content in the water Because ofthe diffusion tubes there will be plenty of oxygen on the pond bottom throughout ... as 90% of their production for at least one ofthe crops during the year (Funge-Smith and Stewart, 1996) During the summer of 1997, the Thai economy collapsed andthe government floated the currency...
... follow two main kinds of empirical methods On the one hand there are a numberof studies comparing pre- and post-merger performance On the other hand, another strand ofthe empirical literature ... for the target, the bidder andthe combined entity shareholders.3 The underlying hypothesis of these types of studies is that excess returns around announcement day could explain the creation of ... Bankscope and Thomson Financial Deals The relationship between the relative size of target and bidder (RSIZE) – measured as the ratio of total assets ofthe target bank to total assets of bidder – and...
... information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca andthe adjacent waters ofthe Andaman Sea andthe Indian Ocean In the process, an attempt ... TAI The Straits of Singapore The Straits of Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The ... portion ofthe waters lies within the continental shelf areas of 10 to 60m in depth The deepest area (70m) is in the Andaman Sea at the northern tip ofthe Straits, while the shallowest is at the...
... B), and Suppliers (Panel C) Similar to the results of previous sections, each of these three panels measures the frequency of adoption ofthe focal practice within each ofthe two groups, andthe ... engagement In particular, each item in Table measures the frequency of adoption ofthe focal practice within each ofthe two groups, andthe last column presents a significance test ofthe differences ... chosen companies that survived and operated throughout the early 1990s and until the late 2000s The better performance ofthe firms in both samples compared to the rest ofthe market may be attributed,...
... Working with other depart ents and with partners 14 m Structure ofthe Department of Maternal, Newborn, Child and Adolescent Health 16 Annex: Functions ofthe teams and cross-cutting ... Regional and Country Offices and partners to: • Generate and synthesize evidence and define norms and standards for maternal, newborn, child and adolescent health; • Support the adoption of evidence-based ... understanding ofthe needs of pregnant women, children and adolescents, andthe types of interventions that will result in the highest possible gains in health, growth and development Therefore, the...
... conceived for various purposes The health ofthe mother is closely linked to the health and survival ofthe child In addition, the socio-economic level ofthe mother andthe maternal health status ... -2008 - 2015 ofthe health system in a coherent and effective manner that is responsive to the needs ofthe mother, the newborn andthe child • Evidence-based approach: ensuring that the interventions ... line with the National Health Policy and existing MNCH standards, guidelines and protocols The Government highly values your partnership in working towards realization ofthe objectives ofthe National...
... [35,36,40,41] The apocyt b5 and apo-Mb have no absorption in the Soret band region because ofthe lack ofthe heme prosthetic group For the holo-cyt b5 and holo-Mb, the CD spectra ofthe Soret band are ... b5 and metMb The heme transfer reaction consists of two steps: the first step is the release ofthe heme from cyt b5, andthe second step is the binding of apo-Mb with the heme b [30] Because the ... displays the conserved conformation in the structures ofthe Phe35fiTyr mutant andofthe wild-type protein as well as other mutants However, the conformation ofthe latter is flexible CD spectra of thermal...