primate neuroethology mar 2010
... (Lemuroidea) and the lorises and galagos or bushbabies (Lorisoidea) of Africa and Asia The two groups differ systematically in a number of anatomical details, particularly of the cheek teeth and the middle ... extension of the bony ring (ectotym panic) around the eardrum and the loss of the anterior premolar Nevertheless, there are a few candidate synapomorphies of the New World monkeys, mainly in details of ... Together, the chapters in the first section of the book clearly endorse the notion that under standing the neurobiology of primate behavior and cognition will profit from an evolutionary and...
Ngày tải lên: 11/06/2014, 10:15
... Reducing the health consequences of smoking: 25 years of progress; a report of the Surgeon General Rockville, MD: U.S Department of Health and Human Services, CDC, Office of Smoking and Health; ... The number of obese Medicare beneficiaries nearly doubled from 1987 to 2002, and the spending incurred by them almost tripled.15 Overweight and obesity is also a crisis among children The number ... Statistics Group; U.S Department of Commerce, Bureau of Economic Analysis; and U.S Bureau of the Census 11 Soni A Personal health behaviors for heart disease prevention among the U.S adult civilian...
Ngày tải lên: 14/02/2014, 13:20
... Reducing the health consequences of smoking: 25 years of progress; a report of the Surgeon General Rockville, MD: U.S Department of Health and Human Services, CDC, Office of Smoking and Health; ... The number of obese Medicare beneficiaries nearly doubled from 1987 to 2002, and the spending incurred by them almost tripled 15 Overweight and obesity is also a crisis among children The number ... Statistics Group; U.S Department of Commerce, Bureau of Economic Analysis; and U.S Bureau of the Census 11 Soni A Personal health behaviors for heart disease prevention among the U.S adult civilian...
Ngày tải lên: 22/03/2014, 15:21
Solution for the perfection of Viettel strategic business market in Cambodia (2010 - 2015)
Ngày tải lên: 26/03/2015, 09:41
THE ROLE OF TRANSFORMATIONAL LEADERSHIP BEHAVIORS IN AFFECTIVE EMPLOYEE ENGAGEMENT AN EMPIRICAL STUDY IN THE TWO INDUSTRIES OF RETAIL AND FINANCIAL SERVICES IN HO CHI MINH CITY
... the process of completing this thesis Without the support and encouragement from Dr Lam and Dr Tho, the thesis might not be possible in meeting the requirements and expectations of the research ... considered a particular group and therefore the results cannot be generalized to represent for the whole industry or other various types of organizations in Vietnam 1.7 STRUCTURE OF THE STUDY The thesis ... specific situations, the nature of the work, the nature of environment, and subordinates So it proposes the styles of leadership might be different in different levels in the organization Situation...
Ngày tải lên: 01/06/2015, 20:09
Four essays on the economics of pro social behaviors
... transfers Furthermore, there are two common triggers of third-party punishment and compensation: inequality in payoffs between the third party and the relevant reference player, and violation of the fairness ... and the accompanying title of honor; and the category thresholds themselves We broadly define the former as the publicity effect of category reporting, and the latter as the category effect of ... between these two effects, and the result of his empirical analysis on the prestige motive for giving may be confounded by the presence of the category effect Our study disentangled the impact of the...
Ngày tải lên: 10/09/2015, 09:03
essays in behavioral economics in the context of strategic interaction
... Model Estimation the proportion of naive types (simply the sum of the relevant previous lines) and the estimate of the proportion of risk neutral types (again, simply the sum of the relevant previous ... test, we test the hypothesis whether the proportion of naive types is the same in different pairs of treatments as well as the hypothesis whether the proportion of risk neutral types is the same in ... combinations of elements) of θ 34 In B (C) the estimate of pN RA (pN RN ) is on the boundary of the parameter space We not compute the standard error for this estimate since the standard error...
Ngày tải lên: 03/06/2014, 01:07
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank Influent was 60L/day pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic tank The water temperature ... the laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the...
Ngày tải lên: 05/09/2013, 09:38
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... that they are at the mercy of the MFIs and they not have any idea about the merits of the loan products They will have higher satisfaction and confidence if the said MFIs are supported and recognized ... for their increment at the end of each year On the other hand, lower income group running their own businesses are encouraged by MFIs to obtain loans as the capacity building of the enterprise and ... Pakistan, the loan size is not as per the expectation of the borrowers who requires the loan majorly for the inventory storage enhancement of the business Majority of the total respondents in both the...
Ngày tải lên: 06/09/2013, 05:48
CHAPTER 5 The Logic of Group Behavior In Business and Elsewhere
... the profits of the firms producing them The increased profit will give the proprietors of these firms the financial ability, and the motivation, to obtain additional inputs to expand output of ... violate the privacy and trust of their workers, they engage in a form of fraud They effectively ask their workers to take a lower rate of pay than they would otherwise demand, and then don’t give their ... cost, apart from the costs suffered by others, but notice that the cost suffered by one person is only a minor part of the total cost, and the greater the number of attendees at the meetings, the...
Ngày tải lên: 17/12/2013, 15:18
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... (2) the target's MOA; and (3) the use of the tools of education, marketing, and law Figure I shows the eight segments of any market that result from the combinations of the presence or absence of ... and accommodate the target's MOAs and the trade-off of free choice and externalities The potential for success of the three sets of tools is derived from the target's assessment of the "risk premium" ... (1935), The Generic Nature of the Concepts of Stimulus and Response,” Journal of General Psychology, 12, 40-65 Smith, Adam (1776), An Inquiry Into The Nature and Causes of the Wealth of Nations,...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu The Basics of Social Marketing - How to Use Marketing to Change Behavior docx
... grandmothers as the appropriate source for the intervention The grandmothers who participated in formative research developed the chitterlings cleaning method for their peers Having the grandmothers ... to do, and how it affects the desired change? ® Taken together, will the overall mix of interventions reach enough of the target audience often enough to have the desired impact? ® Is the overall ... workshops), and other media Promotion leads you to consider the type of media your target audience attends to, when and where they will attend to your messages, and the characteristics of the communication...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu STRATEGIC ENVIRONMENTAL ASSESSMENT on shrimp farms in the southeast of Thailand docx
... sulphide and ammonia The heavy aeration in this method for shrimp farming further increases the amount of sludge and thereby the amount of organic material on the bottom of the pond through erosion The ... recirculation of the pond water and the use of treatment ponds, which decrease the amount of organic content in the water Because of the diffusion tubes there will be plenty of oxygen on the pond bottom throughout ... as 90% of their production for at least one of the crops during the year (Funge-Smith and Stewart, 1996) During the summer of 1997, the Thai economy collapsed and the government floated the currency...
Ngày tải lên: 26/02/2014, 20:20
WORKING PAPER SERIES NO. 398 / OCTOBER 2004: MERGERS AND ACQUISITIONS AND BANK PERFORMANCE IN EUROPE THE ROLE OF STRATEGIC SIMILARITIES potx
... follow two main kinds of empirical methods On the one hand there are a number of studies comparing pre- and post-merger performance On the other hand, another strand of the empirical literature ... for the target, the bidder and the combined entity shareholders.3 The underlying hypothesis of these types of studies is that excess returns around announcement day could explain the creation of ... Bankscope and Thomson Financial Deals The relationship between the relative size of target and bidder (RSIZE) – measured as the ratio of total assets of the target bank to total assets of bidder – and...
Ngày tải lên: 06/03/2014, 09:22
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt ... TAI The Straits of Singapore The Straits of Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The ... portion of the waters lies within the continental shelf areas of 10 to 60m in depth The deepest area (70m) is in the Andaman Sea at the northern tip of the Straits, while the shallowest is at the...
Ngày tải lên: 06/03/2014, 15:21
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx
... B), and Suppliers (Panel C) Similar to the results of previous sections, each of these three panels measures the frequency of adoption of the focal practice within each of the two groups, and the ... engagement In particular, each item in Table measures the frequency of adoption of the focal practice within each of the two groups, and the last column presents a significance test of the differences ... chosen companies that survived and operated throughout the early 1990s and until the late 2000s The better performance of the firms in both samples compared to the rest of the market may be attributed,...
Ngày tải lên: 06/03/2014, 20:21
Strategic Directions of the Department of Maternal, Newborn, Child and Adolescent Health ppt
... Working with other depart ents and with partners 14 m Structure of the Department of Maternal, Newborn, Child and Adolescent Health 16 Annex: Functions of the teams and cross-cutting ... Regional and Country Offices and partners to: • Generate and synthesize evidence and define norms and standards for maternal, newborn, child and adolescent health; • Support the adoption of evidence-based ... understanding of the needs of pregnant women, children and adolescents, and the types of interventions that will result in the highest possible gains in health, growth and development Therefore, the...
Ngày tải lên: 07/03/2014, 04:20
The National Road Map Strategic Plan To Accelerate Reduction of Maternal, Newborn and Child Deaths in Tanzania 2008 - 2015 potx
... conceived for various purposes The health of the mother is closely linked to the health and survival of the child In addition, the socio-economic level of the mother and the maternal health status ... -2008 - 2015 of the health system in a coherent and effective manner that is responsive to the needs of the mother, the newborn and the child • Evidence-based approach: ensuring that the interventions ... line with the National Health Policy and existing MNCH standards, guidelines and protocols The Government highly values your partnership in working towards realization of the objectives of the National...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: X-ray crystallography, CD and kinetic studies revealed the essence of the abnormal behaviors of the cytochrome b5 Phe35fiTyr mutant pdf
... [35,36,40,41] The apocyt b5 and apo-Mb have no absorption in the Soret band region because of the lack of the heme prosthetic group For the holo-cyt b5 and holo-Mb, the CD spectra of the Soret band are ... b5 and metMb The heme transfer reaction consists of two steps: the first step is the release of the heme from cyt b5, and the second step is the binding of apo-Mb with the heme b [30] Because the ... displays the conserved conformation in the structures of the Phe35fiTyr mutant and of the wild-type protein as well as other mutants However, the conformation of the latter is flexible CD spectra of thermal...
Ngày tải lên: 08/03/2014, 10:20
Division of the Chief Health Officer Strategic Directions for Mental Health Promotion 2009–2012 pptx
... Promotion 2009–2012 is part of a suite of planning and reporting documents which describe the work of the population health services within the Division of the Chief Health Officer The complete suite ... Division of the Chief Health Officer Published by Queensland Health August 2009 ISBN 978-1-921447-79-2 © The State of Queensland (Queensland Health) 2009 The Queensland Government supports and encourages ... other parts of Australia and the world However, there is still a range of population health challenges that need to be addressed The rate of chronic diseases (such as diabetes, heart disease and...
Ngày tải lên: 08/03/2014, 15:20