Ngày tải lên: 14/10/2014, 01:01
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese
... the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese”. 2. Aims of the Study The study is aimed at: * Finding the similarities and differences between the verb ‘run’ in English and the verb ... to transfer the forms and meanings and the distribution of forms and meanings of their native language and culture to the foreign language and culture- both productively and when attempting ... Vietnamese, the verb ‘chạy’ is able to combine with other words to create principle and accessory compound words and jargons belonging to different parts of speech such as nouns, verbs, or adjectives...
Ngày tải lên: 06/04/2013, 08:43
NOUN MADE FROM VERB
... 14 -tion Make nouns ending in -tion from the following verbs, making any necessary spelling changes. Then put each noun in its correct place in the sentences below. revolt pronounce repeat produce compete qualify reduce solve acquire introduce ... __________________ Nouns made from verbs 1 -sis -ure Make nouns ending in -sis or -ure from the following verbs, making any necessary changes in spelling. Then put each noun in its correct ... . (respond) 10 -sion Make nouns, all ending in -sion, from the following verbs. Put each noun in its correct place in the sentences below. divide conclude expand persuade revise admit exclude explode include...
Ngày tải lên: 06/11/2013, 04:11
Báo cáo khoa học: "Interpreting Semantic Relations in Noun Compounds via Verb Semantics" pdf
... head nouns of the subject and object, and also, for each PP attached to that verb, the head preposition and head noun of the 493 WUP JCN RANDOM LESK VECTOR SYN−D SYN−D,I Result with Count Verb mapping ... of head verbs each seed verb occurs with. 6.2 Verb Mapping The sentential contexts gathered from corpus data contain a wide range of verbs, not just the seed verbs. To map the verbs onto seed verbs, ... annotations and arrive at a mutually-acceptable gold-standard annotation for each NC. The Brown, WSJ and BNC data was pre-parsed with RASP, and sen- tences were extracted which contained the head noun and...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "Inducing Frame Semantic Verb Classes from WordNet and LDOCE" pot
... Semantic Verb Classes a. Relates LDOCE verb senses that are defined in terms of the same verb Input. D, a set of (verb_ sense_id, def _verb) pairs, where def _verb = the verb in terms of which d verb_ sense_id ... (verb_ sense_id , related _verb ) pair d d Step 3. forall (verb_ sense_id , related _verb ) pairs, if there is only one sense of related _verb , choose it d d d and return (verb_ sense_id , related _verb_ sense_id ... set more verbs, minimal overlap occurs when two or of verbs shared by FrameNet and SemFrame more verbs in the FrameNet frame are matched by framesets account for half or more of the verbs in verbs...
Ngày tải lên: 17/03/2014, 06:20
Báo cáo khoa học: "Learning How to Conjugate the Romanian Verb. Rules for Regular and Partially Irregular Verbs" docx
... that remain unchanged and ensure that, given the infinitive and the regular expressions, one can work backwards and produce the correct conjugation. For a clearer understanding of one such rule, Table ... between rules 1, 20, 22, and the sort lies in the suffix that is added to the stem for each verb form. They may share some suf- fixes, but not all and/ or not for the same person and number. 1. no alternation; ... most verbs (3,330) is the one modelling those from the 1st conjugational class (whose infinitives end in ”a”) which conjugate with the ”ez” suffix and are regular, namely rule 7, created for verbs like...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: "Using Parse Features for Preposition Selection and Error Detection" ppt
... the preposition, the noun between the verb and the preposition, if any, and the noun after the preposi- tion) to a classifier trained on attachment features which explicitly state whether the preposition ... around the preposition, plus the head verb in the preceding verb phrase (PV), the head noun in the preceding noun phrase (PN) and the head noun in the following noun phrase (FN) when available (Chodorow ... Mixed 9. Head Tag and Comp Token: NNS-country 10. Head Token and Comp Tag: groups-NN Phrase Structure 11. Preposition Parent: PP 12. Preposition Grandparent: NP 13. Left context of preposition parent:...
Ngày tải lên: 30/03/2014, 21:20
what case what preposition verbal and nominal government - какой падеж какой предлог глагольное и именное управление
Ngày tải lên: 17/04/2014, 15:05
Báo cáo y học: "An unusual case of gout in the wrist: the importance of monitoring medication dosage and interaction. A case report"
... men and 0.1–0.6% in women [2]. The prevalence rises to 4.4% of men and 1.8% of women over the age of 65 [4]. A two-fold increase in incidence of gout has been reported in the USA and New Zealand ... recurrent acute gouty attacks and is characterized by persistent pain and swelling in the affected joints. Classic radiographic features include soft tissue densities (tophi) and para-articular bony ... education is very important and patients who have had a previous attack of gout should be made aware of common signs and symptoms, treatment protocols during an acute attack, and that gout may occur in...
Ngày tải lên: 25/10/2012, 10:06
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt
... 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile. Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively. FAD and FMN standards were used ... AAAA CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG. MfeI and PstI sites were inserted in for- ward and reverse primers, respectively, upstream and down- stream the start and the stop codons, whereas a (His) 6 - coding ... The amplified DNA was digested by MfeI and PstI and ligated into the ampicillin-resistant expression vector pSD80 [43], which was digested by EcoRI and PstI, and introduced by electroporation in...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Binding affinities and interactions among different heat shock element types and heat shock factors in rice (Oryza sativa L.) ppt
... In Arabidopsis, homomeric interactions for HsfA1a and HsfA1b as well as heteromeric interaction between HsfA1a and HsfA1b were noted [6]. Both HsfA1a and HsfA1b also make heteromeric interactions with HsfA2; ... (synthetically defined tryptophan and histidine dropout medium) and SD-WH + 1 m M 3-AT and WH + 5 mM 3-AT (synthetically defined tryptophan and histidine dropout media with 1 and 5 m M of 3-AT). The lane ... binding at 32 and 37 °C; OsHsfA9 showed efficient binding at 22, 32 and 37 °C; and OsHsfB4b showed maximum binding at 22 °C. In con- trast, the DNA affinity of OsHsfA7, OsHsfB4c and OsHsfC1b polypeptides...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... Cys in the mature protein sequence (TSST-1, SPEB, SMEZ1 and 2), three have one Cys (SEI, SEK and SPEC), two have three Cys (SEG and SPEA) and only SSA has more than that, five Cys. As discussed ... 10, 20 and 40 l M ) and immobilized SSA (A) or SSA(C26S) ( B). D a ta s ets w ere measured fi v e minutes after injection. Dissociation curves between Vb5.2 (10, 20, 40 l M )andSSA(C) and SSA(C26S). ... set between 5 and 7 min to couple the desired amount of proteins yielding between 400 and 600 arc s econds. Micromolar concentrations of SAgs [SSA and SSA(C26S)] or b chains (Vb1, V b2.1 and V b5.2)...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): molecular structure and interactions with HGFA inhibitor-1 (HAI-1) doc
... al. [4]. Substrate interaction and specificity The structures of the substrate mimic KQLR-cmk bound to HGFA and the KD1–HGFA complex pro- vide insights into salient features determining substrate interactions and ... chain hydrogen bonds between P1 Arg and Ser214 and between P3 Gln and Gly216 (Fig. 3A). S1 is filled with the P1 Arg, which engages in standard salt bridge interactions with HGFA Asp189, located ... native HGFA and chymotrypsinogen residue numbers, see [4]), and we employ the nomenclature of Schechter and Berger [5] in describing specific sites of protease–substrate (or inhibitor) interactions....
Ngày tải lên: 15/03/2014, 11:20
Multimedia Semantics: Metadata, Analysis and Interaction pdf
... and store data, it also becomes more difficult to access and locate specific or relevant information. This book addresses directly and in considerable depth the issues related to representing and ... year. The problem is one of efficient management of and access to the photos, and that manual labeling and annotation by the user is tedious and often not sufficient. Parallel to this, the number ... and reuse photos across social media platforms. Not only are there different ways of automatically and manually annotating photos, but also there are many different standards for describing and...
Ngày tải lên: 15/03/2014, 11:20
Learning Processing - A Beginner’s Guide to Programming Images, Animation, and Interaction doc
... Do something over and over and over and over (and over … ) again until the program quits. Consider how you might go about running a race. Step 1. Put on your sneakers and stretch. Just do ... used to take you a whole day to program can be done in fi ve minutes. And it works on a Mac. And a PC! And a toaster oven! And you can program your pets to speak with it. In Japanese! Here’s ... expect? Interaction 31 3 Interaction “ Always remember that this whole thing was started with a dream and a mouse. ” —Walt Disney “ e quality of the imagination is to fl ow and not to...
Ngày tải lên: 17/03/2014, 12:20