nonharming as a gift to the world
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... of the American Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia ... on the transmission disease There are two major classes of influenza virus, type A and B these two classes have similar structures, but all A virus proteins are different from B as far as the ... change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able to withstand temperate, moisture and ph changes...
- 4
- 520
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... phosphate isomerase, UÆmL)1 glycerol 3-phosphate dehydrogenase and 0.3 U aldolase PK was assayed as described by Crow and Pritchard [30] Final concentrations in assay was: mm GDP, mm PEP, mm fructose ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways, ... properties of the lipid phase [35] The mechanisms highlighted above conceivably also operate in the present case The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity ... Immediately after treatment, the cells were cooled to °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired...
- 10
- 452
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... The responsibility of the scientists is to screen among these alternatives the feasible measures based on applicability and suitability for the local conditions. 2.4. Evaluation criteria After the problem and its constraints have ... and accounts for 75% to 85% of the total yearly rainfall, whereas the dry season lasts up to 6 months, from February to July and occupies only 15‐25% of the total rainfall. ... on diseases. Finally, the impact and area of impact are important for the aquaculture, agriculture, industries and other land users. Based on these criteria and the preference ...
- 13
- 487
- 0
RIDDING THE WORLD OF POPS: A GUIDE TO THE STOCKHOLM CONVENTION ON PERSISTENT ORGANIC POLLUTANTS potx
Ngày tải lên :
22/03/2014, 14:20
... equipment” such as electrical transformers and capacitators containing PCBs, as long as the equipment is maintained in a way that prevents leaks It grants them another three years to destroy the recovered ... good at killing and repelling the mosquitoes that spread malaria In regions where malaria still poses a major health hazard, that is a huge benefit Malaria kills at least million people a year, ... dumps of these toxic substances These stockpiles and waste sites have to be found, managed so that leaks and other releases into the environment are minimized, and ultimately cleaned up in a safe,...
- 24
- 522
- 0
a beginner's guide to the world economy
Ngày tải lên :
05/06/2014, 10:58
... D-mark The riyal, in Saudi Arabia and Qatar, and the rial in Iran, are based on the Spanish word real-which was derived from the Latin regal(is), referring to earlier "royal" coins 18 R A N ... not the only way to measure an economy's size, it is the easiest way to sum up the value of all the apples and oranges, football games and computers, automobiles and college classes that a country ... to facilitate a payment to Nigeria's central bank or the Bank of Japan may use the BIS to transfer funds to the U.S Federal Reserve The key for any international transfer is to have a central...
- 217
- 1.8K
- 0
a guide to the end of the world everything you never wanted to know sep 2004
Ngày tải lên :
11/06/2014, 10:21
... well after the bell has rung and the athletes are hurtling down the final straight of the last lap As they battle for the tape, dinosaurs appear and then disappear while the leaders Page A VERY ... the Atlantic Ocean, bisecting Iceland, and separating the Eurasian and African plates in the east from the North and South American plates in the west Here too there are both volcanoes and earthquakes, ... how many other names there are You have reason to believe, however, that there is a 50 per cent chance that the total number is a thousand and an equal probability that the total is ten When the...
- 212
- 445
- 0
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps
Ngày tải lên :
09/08/2014, 10:21
... H37Ra (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg ... Murihead KA, Hanna N: Methotrexate inhibits macrophage activation as well as vascular and cellular inflammatory events in rat adjuvant induced arthritis J Rheumatol 1988, 15:745-749 47 Davis P, ... Statistical Package for the Social Sciences software (SPSS Inc Chicago, IL, USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the...
- 7
- 569
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
Ngày tải lên :
09/08/2014, 18:21
... metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs ... bird karyotypes seem very well conserved between ratites and carinatas !17! The appearance of microchromosomes could precede bird adaptative radiation at the end of the Jurassic, beginning of the ... the total number of chiasmatas) is 90-100 in birds, whereas it is on average 50 in mammals [68] Moreover, the domestic species studied (dog, cat, pig, cattle, etc.) tend to have higher chiasma...
- 11
- 318
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
Ngày tải lên :
11/08/2014, 00:23
... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea ... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching ... brainstorming sessions and search in the literature to find the potential causes, then categorize these causes in an Ishikawa diagram The Ishikawa diagram can then be kept by individual learners...
- 3
- 381
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
Ngày tải lên :
12/08/2014, 18:20
... Several useful SNP databases are available on the World Wide Web (see Table 1); these databases are constantly updated and are growing rapidly However, the data contained in them are far from infallible ... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...
- 11
- 491
- 0
Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided
Ngày tải lên :
30/09/2015, 16:58
... compliance Hence, a National Market company may transfer to the Nasdaq SmallCap Market, provided all other listing requirements are met, in order to take advantage of the additional 180 day grace ... faxed to the NYSE as required by Section 204.16 The notice to the exchange should be provided as soon as possible after the declaration date and preferably, at least ten days in advance of the ... reverse stock split are identified Other financial data pertaining to the companies announcing a reverse stock split are also gathered during this phase The second phase of the study evaluates market...
- 217
- 227
- 0
Welfare and economy wide effects of azerbaijan’s accession to the world trade organization a quantitative assessment
Ngày tải lên :
26/11/2015, 10:00
... FTA GAMS GATS GATT GDP GTAP HBS IO ITC MacMap MERCOSUR MIRAGE NAFTA OECD PPF ROW SAM SNA SOCAR SSAP TRIPS UNCTAD USA WTO Agreement on Agriculture Association of Southeast Asian Nations Computable ... Payment is granted based on the area sown at a rate of 10 THE WTO AND THE RELEVANT ECONOMIC POLICY OF AZERBAIJAN AZN 40, generating an average annual cost to the government of approximately AZN ... of the Uruguay Round, it has basically replaced the General Agreement on Tariffs and Trade (GATT) As a multilateral agreement, GATT played an important role in the regulation of international...
- 195
- 419
- 0
Law as a Means to an End Threat to the Rule of Law Law in Context
Ngày tải lên :
13/10/2016, 11:31
... law, as an orientation of lawyers in their daily practice, as a strategic approach of organized groups that use litigation to further their agendas, as a view toward judges and judging, as a ... we breathe This operates in various ways: as an account of the nature of law, as an attitude toward law that professors teach students, as a form of constitutional analysis, as a theoretical perspective ... regulated by law; the law in force in England was assumed to be the common law; all common law was assumed to be custom, elaborated, summarized and enforced by statute; and all custom was assumed...
- 269
- 904
- 0
UNIT 13:A TRIP TO THE COUNTRYSIDE
Ngày tải lên :
01/06/2013, 08:47
... site next to the river It was a beautiful day, my friends and I decided to go on a picnic We took a bus to the countryside and then walked about 20 minutes to the picnic site next to the river ... bus stop When… looked at the time, it was nearly 6.30 When we pm We hurriedly gathered our things and ran to the bus stop When we looked at the time, it was nearly 6.30 pm We hurriedly gathered ... things and ran to the bus stop we / lucky / catch / last bus / and / we / arrive / home / very late / evening We were lucky to catch the last bus and we We… arrived home very late in the evening...
- 19
- 1.2K
- 2
Unit 3: A trip to the countryside. Lesson 18
Ngày tải lên :
21/06/2013, 01:25
... he also helps on the (7) ……… The family relaxes on Saturday farm afternoons and (8)…… Peter play (9) they watch …… Van likes the Parkers, and he baseball enjoys being a (10) …… of their family ... than standard time 2- c 3- b 4- e 5- a b.Complete the summary Use information from the passage A VietNamese boy named Van is living with the Parker family in the American state of (1) …… Mr Parker ... while Mrs Parker works part-time at a grocery store a farmer F They have three children F Van feeds the pigs and collects their eggs two the chickens T The Parker family and Van eat hamburgers...
- 21
- 874
- 1
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2