nkx3 1 and nk2 transcription factor related locus 5 nkx2 5

... 1. 1.4 Copper metabolism and disease 27 1. 1.4 .1 PARP -1 and Copper metabolism .29 1. 1 .5 1. 2 1. 3 1. 4 Genomic Instability 1. 1 .1. 1 Telomere mediated genomic instability .2 1. 1 .1. 1 .1 ... .14 1. 1.2.3 Radiation 18 1. 1.3 Mechanisms for preventing genomic instability 20 1. 1.3 .1 Poly (ADP-ribose) polymerase (PARP -1) 21 1 .1. 3 .1. 1 Role of PARP -1 at the telomeres 24 1. 1.4 ... .xvii Chapter 1: Introduction 1. 1 Review of Literature 1. 1 .1 1 .1. 2 Inducers of genomic instability 10 1. 1.2 .1 Oxidative stress 10 1. 1.2.2 Arsenic-induced...

Ngày tải lên: 11/09/2015, 10:18

... and M Irie, Macromolecules 23: 15 17 15 19 (19 90) 38 N Yui, T Okano, and Y Sakurai, J Controlled Release 26: 14 1 14 5 (19 93) 39 N Yui, T Okano, and Y Sakurai, J Controlled Release 22: 10 5 11 6 (19 92) ... 13 0 12 00 2800 19 00 4.6 29 15 00 50 00 0.70 0. 75 0.49 0 .1 (k 11 ) 0 .17 — 0.94 2 85 593 19 0 2.3 (d 11 ) 480 250 0 50 0 65 500 >10 6 12 10 80 17 5 — 70 Figure 12 A self-regulated heater element fabricated ... 297–308 (19 95) 28 T Krusche and W Michaeli, 41st Int SAM Anaheim, CA, March 19 96, pp 15 42 15 50 Mai, Smart Mater Struct 7 (1) : 12 1 12 7 (19 98) 36 J.E Eder and J.L Rose, ASME Appl Mech Div 18 8: 17 9 18 6...

Ngày tải lên: 13/08/2014, 05:20

... activity A + 81 -16 83 -12 89 -12 04 -10 17 -834 -6 61 -634 - 51 2 -389 -240 -16 0 B 50 15 0 10 0 200 A B C D E F G H I L M 250 2 75 HepG2 Relative luciferase activity A B C D E F G H I L M 50 10 0 C 6, 212 ,5 Relative ... 13 14 15 16 17 12 fold molar excess of competitor 12 25 12 25 Sp1/3 Sp3 Sp1/3 * Sp3 * 23 24 25 26 er r Sp 1m e 31 32 33 34 35 fold 25 50 25 molar excess of competitor 50 25 50 10 0 10 0 28 29 Jm ... locus P1 promoter 10 11 er r r – Im me er er Em F/G Sp 1m e Competitor Jm D/ er F/G me r H/ Im er Km er Lm er Sp 1m Competitor – Sp1mer Probe H/ Sp1mer Probe G Feriotto et al 12 13 14 15 16 17 ...

Ngày tải lên: 23/03/2014, 07:20

... 19 60 8 05 51 4 (406) (13 74) (780) ( 710 ) ( 613 ) (809) (740) (54 2) (10 47) ( 752 ) (277) 19 64 15 61 1008 15 96 9 05 12 97 11 42 468 14 03 276 206 (37) (57 ) (19 ) ( 51 ) ( 21) (37) (47) (47) (10 6) (3) (3) a Weighted ... 13 14 15 16 17 18 19 20 21 22 23 24 25 26 nuclear 1H 13 C correlation spectroscopy J Am Chem Soc 11 0, 755 7– 755 8 Kay LE, Torchia DA & Bax A (19 89) Backbone dynamics of proteins as studied by 15 N ... ± 0 .5 K and at 11 .7 T on a Bruker (Karlsruhe, Germany) Avance500 spectrometer, operating at 50 0 .13 MHz and 50 .68 MHz for H and 15 N, respectively The longitudinal (R1) and transverse (R2) 15 N relaxation...

Ngày tải lên: 18/02/2014, 16:20

... 273 (2006) 23 45 2 356 ª 2006 The Authors Journal compilation ª 2006 FEBS 2 355 Insulin induces HO -1 52 53 54 55 56 57 E.M Harrison et al 3-kinase ⁄ Akt cell survival pathway in PC12 cells: protective ... HO -1 expression, including heat shock transcription factor -1 (HSF -1) , hypoxia-inducible factor -1 (HIF -1) and NF-E2 -related factor (Nrf2) The PI3K ⁄ Akt pathway has been implicated in HSF -1 regulation ... glutamax, penicillin (10 0 UÆmL )1) , streptomycin 10 0 lgÆmL )1) (all Gibco), 1 insulin ⁄ transferrin ⁄ selenium, dexamethasone ( 35. 7 ngÆmL )1) and epidermal growth factor ( 25 ngÆmL )1) Tubules were cultured...

Ngày tải lên: 07/03/2014, 12:20

... 1 4, T 211 , TTF -1 sites at ) 358 ⁄ ) 355 and ) 353 ⁄ ) 350 ; lanes and 6, mutated T 211 ; lanes 7 10 , T 212 , TTF -1 sites at )709 ⁄ )706 and )700 ⁄ )697; lanes 11 and 12 , mutated T 212 Lanes 1, 5, and 11 , ... T2 41 T238 T84 T242 T239 T 254 Consensus GATA Muc5b TTF -1 ( )11 2 ⁄ )10 9) TTF -1 () 358 ⁄ ) 355 ; ) 353 ⁄ ) 350 ) Mutated T 211 TTF -1 ()709 ⁄ )706; )700 ⁄ )697) Mutated T 212 TTF -1 ()3 25 ⁄ )322) GATA ( )11 43 ... at ) 411 ⁄ )408), T 254 (GATA at ) 454 ⁄ )449) and T84 (GATA at )11 43 ⁄ )11 40) radiolabeled DNA probes Lanes 1, and 14 , radiolabeled probes alone; lanes 2, and 15 , incubation of T242, T 254 and T84...

Ngày tải lên: 15/03/2014, 00:20

... (2009) 11 14 11 24 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS 11 15 SP1 and AP-2a regulate KCTD10 R Liu et al A B Fig Genomic structure of human and mouse KCTD10 genes, and the 5 -flanking ... patch in transcription factor Sp1 contacts the dTAFII 110 component of the Drosophila SP1 and AP-2a regulate KCTD10 16 17 18 19 20 21 22 23 24 25 26 27 28 TFIID complex and mediates transcriptional ... characterization and roles of Sp1 and AP-2 in the basal transcription of mouse PDIP1 gene FEBS Lett 57 9, 17 15 17 22 11 24 31 Bzowska M, Jura N, Lassak A, Black RA & Bereta J (2004) Tumour necrosis factor- alpha...

Ngày tải lên: 30/03/2014, 02:20

... 18 10S: 18 18S: 18 30S: 18 39S: 18 51 S: 18 61S: 18 72S: 18 77S: 18 91S: 19 04S: 19 14S: 19 24S: 19 43S: C-terminal deletions 19 55 A: 19 02A: 18 89A: 18 77A: 18 70A: 18 62A: 18 51 A: 18 43A: 18 32A: GATCGAATTCTCCTCTGAGCTGTCGTCTTGTA ... primers including a SalI site: 19 55 A, 19 02A, 18 89A, 18 77A, 18 70A, 18 62A, 18 51 A, 18 43A, 18 32A, 18 21A, 18 10A, 18 01A and 17 90A The common sense primer was 16 76ST and included and EcoRI site The same series ... from 16 76 to 18 10 (end points at 18 01 and 18 10 not shown) 14 38 Unlike the effects on PS1 transcription (Fig 6A), further deletions with end points at amino acids 18 10, 18 18, 18 30, 839, 18 51 and 18 61...

Ngày tải lên: 30/03/2014, 09:20

... Plant Cell Physiol 2003, 44 (11 ) :11 31- 114 0 doi :10 .11 86 /14 71- 2229 -11 -14 2 Cite this article as: Galbiati et al.: The grapevine guard cell -related VvMYB60 transcription factor is involved in the regulation ... 2 011 , 11 :14 2 http://www.biomedcentral.com /14 71- 2229 /11 /14 2 36 37 38 39 40 41 42 43 44 45 46 Page 14 of 14 altered cellular priorities during hypoxia in Arabidopsis PNAS 2009, 10 6(44) :18 843 -18 848 ... VvMYB30, VvMYB60 and AtMYB60 (Additional file 1) Galbiati et al BMC Plant Biology 2 011 , 11 :14 2 http://www.biomedcentral.com /14 71- 2229 /11 /14 2 Page of 14 Figure Analysis of grape and Arabidopsis...

Ngày tải lên: 11/08/2014, 11:21

... and IL -1 but not complement Am J Pathol 19 98, 15 2 :13 27 -13 36 Lentsch AB, Czermak BJ, Jordan JA, Ward PA: Regulation of acute lung inflammatory injury by endogenous IL -13 J Immunol 19 99, 16 2 :10 71- 1076 ... science review: Redox and oxygen-sensitive transcription factors in the regulation of oxidant-mediated κ lung injury: role for nuclear factor- κB Crit Care 2002, 6:4 814 90 10 11 12 13 Haddad JJ: Basic ... vascular endothelial growth factor (VEGF) and glucose transporter [9 11 ] Work by Haddad [12 ,13 ] has demonstrated that proinflammatory cytokines also activate HIF -1 stability and DNA binding This effect...

Ngày tải lên: 12/08/2014, 19:21

... Physiology and Behavior 19 94; 56 : 51 1 - 51 6 66 Tarkka IM, Stokic DS Source localization of P300 from oddball, single stimulus, and omitted-stimulus paradigms Brain Topography 19 98; 11 :14 1 - 15 1 67 Polich ... months time [10 2] Acute cortical damage to auditory processing structures might be assessed objectively in a complementary manner, via studies of the MMN [10 3] 15 2 10 11 12 13 14 15 16 17 18 Closing ... Alcohol 19 98; 15 :11 9-36 92 Porjesz B And Begleiter H Human brain electrophysiology and alcoholism In: Tarter R and Thiel DV, Eds Alcohol and the Brain New York: Plenum Press, 19 85 :13 9 -18 2 93 Hada...

Ngày tải lên: 02/11/2012, 11:08

... NK1 (nM) 75 10 0 80 60 40 20 3.4 6.8 13 .5 27 54 Protease concentration (nM) TMPRSS13 (nM) HAI -1- NK1 (µM) Pro-HGF HGF heavy-chain HAI -1- NK1 HGF light-chain 50 37 (kDa) 0 54 54 10 0 75 50 37 25 (kDa) ... TMPRSS13 (nM) NK1LK2 (nM) 10 0 75 Boiled B 50 (kDa) IB: HAI -1 B TMPRSS13 (nM) NK1 (nM) Not boiled 20 75 * * 50 37 (kDa) TMPRSS13 (nM) NK1 (nM) 75 Boiled 50 37 (kDa) 20 200 20 20 20 TMPRSS13 (nM) NK1LK2 ... Pro-TMPRSS13 Nonreduced 250 15 0 10 0 75 63 37 37 25 (kDa) DDDDKIVGG 63 50 25 myc-His-C 250 15 0 10 0 75 50 SS N (kDa) Enterokinase SS N myc-His-C IB: anti-c-Myc IB: anti-c-Myc Fig Production and activation...

Ngày tải lên: 15/02/2014, 01:20

... 20, 10 3 11 1 17 Meisenhelder J, Suh PG, Rhee SG & Hunter T (19 89) Phospholipase C-c is a substrate for the PDGF and EGF receptor protein-tyrosine kinases in vivo and in vitro Cell 57 , 11 09 11 22 18 ... Karin M (19 88) Oncogene jun encodes Role of AP1 in EGF-mediated cell protection 41 42 43 44 45 46 47 48 49 50 51 52 53 a sequence-specific trans-activator similar to AP -1 Nature 332, 16 6 17 1 Ryder ... Oncogene 17 , 13 1 14 1 15 Geier A, Beery R, Haimsohn M, Hemi R, Malik Z & Karasik A (19 94) Epidermal growth factor, phorbol esters, and aurintricarboxylic acid are survival factors for MDA-2 31 cells...

Ngày tải lên: 19/02/2014, 06:20

... Osteosarcoma [ 71] Hepatocyte apoptosis and foetal death [72] Proliferative disease [73] Proliferative disease [74] Proliferative disease [ 75] 27 23 18 18 15 17 .3 18 .5 20.2 27 .1 14 14 13 12 6.6 4 .1 10 .5 RelA ... Elk -1, SAP-1a, MHox(K-2), Fli -1 o Egr-B, SAP-1b, BRIP1, pRB, p130, DP -1, DP-2, E2F -1, E2F-2, E2F-3, p107, E2F-4, E2F -5, E2F-6, HDAC3, HDAC1, HDAC2, YAF2, ADA3, BRCA1, WT1, 53 BP1, PML-3, MTA1-L1, ... MOP3, ERR1, HIF-1a, Arnt, SRC -1, HNF-4a2, EPAS1, HNF-4a3, HNF-4a1 ER-b, ZER6-P 71, CtBP1, PGC -1, SKIP, Smad2, Smad3, Smad4, b-catenin, HOXB13, LEF -1, Evi -1, TCF-4E, TCF-4B, Pontin52, APC, Smad1, Smad6,...

Ngày tải lên: 19/02/2014, 07:20

... Duhamel, L., Charon, D & Kirilovsky, J (19 91) The bisindolylmaleimide GF 10 9203X is a potent and selective inhibitor of protein kinase C J Biol Chem 266, 15 7 71 15 7 81 35 Street, I.P., Lin, H.K., Laliberte, ... kinase C and novel phorbol ester receptors FASEB J 13 , 16 58 16 76 Ó FEBS 2004 Synergistic ERK activation by EGF and PMA (Eur J Biochem 2 71) 3 913 45 Zhang, W., Dziak, R.M & Aletta, J.M (19 95) EGF-mediated ... silico biology Nat Biotechnol 18 , 11 47 11 50 Kitano, H (2002) Systems biology: a brief overview Science 2 95, 16 62 16 64 Kholodenko, B.N., Demin, O.V., Moehren, G & Hoek, J.B (19 99) Quantification of short...

Ngày tải lên: 19/02/2014, 16:20

... genes and maps to human chromosome 11 p13 15 , a region subject to LOH and rearrangement in human carcinoma cell lines Oncogene 17 , 2 719 –2732 Inoue H, Yokoyama C, Hara S, Tone Y & Tanabe T (19 95) Transcriptional ... Friis RR, Hynes NE & Benz CC (19 98) The epithelium-specific ets transcription factor ESX is associated with mammary gland development and involution FASEB J 12 , 15 41 15 50 Neve RM, Ylstra B, Chang ... such as IL -1 [ 21] , and TNF-a [ 21] can also induce ESE -1, and ESE -1 target genes with regard to inflammation so far identified by us include iNOS, COX-2 and potentially MMP -1 and MMP -13 (X Gu, F...

Ngày tải lên: 19/02/2014, 17:20

... HTLV1 LTR Ets-responsive region by transcription factors Ets1 and Sp1 EMBO J 12 , 11 69– 11 78 43 Schaefer, T.S., Sanders, L.K & Nathans, D (19 95) Cooperative transcriptional activity of Jun and ... sequences Mu-S )10 8/)99 Mu-AS )10 8/)99 Mu-S)97/) 91 Mu-AS)97/) 91 Mu-S)87/)80 Mu-AS)87/)80 Mu-S)77/) 71 Mu-AS)77/) 71 Mu-S)68/ )59 Mu-AS)68/ )59 Mu-S )57 / )50 Mu-AS )57 / )50 Mu-S )50 /)44 Mu-AS )50 /)44 CTC CTC ... (2000) IL -10 gene expression is controlled by the transcription factors Sp1 and Sp3 J Immunol 16 5, 286–2 91 46 Schoenherr, C.J & Anderson, D.J (19 95) The neuron-restrictive silencer factor (NRSF):...

Ngày tải lên: 20/02/2014, 11:20

... of Bacillus subtilis 17 88 12 15 16 17 18 19 20 21 glutamate synthase gene expression J Bacteriol 18 2, 59 39 59 47 Fisher SH & Debarbouille M (2002) Nitrogen source utilization and its regulation ... 0 .5 mL of NaCl ⁄ Pi (4.3 mm Na2HPO4, 1. 8 mm KH2PO4, 13 7 mm NaCl, 2.7 mm KCl, pH 8.0) The beads were harvested by short centrifugation (11 50 0 g, 30 s, FEBS Journal 278 (2 011 ) 17 79 17 89 ª 2 011 ... proteins (wild-type and truncated versions), GlnK-ST and GS-ST FEBS Journal 278 (2 011 ) 17 79 17 89 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 17 87 Interaction of TnrA with GlnK and GS A Kayumov...

Ngày tải lên: 06/03/2014, 00:21

... = 10 8 (s )1) Dyy = 10 8 (s )1) Dzz = 10 8 (s )1) s1 = (4Dxx + Dyy + Dzz) )1 (ns) s2 = (Dxx + 4Dyy + Dzz) )1 (ns) s3 = (Dxx + Dyy + 4Dzz) )1 (ns) 0 .10 2 0 .12 5 0 .14 0 14 .86 13 .48 12 . 71 0 .10 1 0 .12 8 0 .13 9 14 .90 ... (2 010 ) 2 611 –2627 ª 2 010 The Authors Journal compilation ª 2 010 FEBS A B Mantsyzov et al 10 11 12 13 14 15 16 17 domain of release factor eRF1 functions in stop codon recognition RNA 6, 12 36 12 47 ... eIF4B, eIF1, eIF1A, eIF5, and eIF5B, 200 pmol of eEF1H and 50 pmol of eEF2 for 30 min, and then centrifuged in a Beckman SW 55 rotor for 95 at °C and 300 000 g (using a Beckman SW 55 rotor) on a 10 –30%...

Ngày tải lên: 06/03/2014, 11:20

... Rep, doi: 10 .10 07/s 110 33- 010 -0476 -5 FEBS Journal 278 (2 011 ) 250 0–2 51 0 ª 2 011 The Authors Journal compilation ª 2 011 FEBS Y Zhong et al 12 Kang D, Kim SH & Hamasaki N (2007) Mitochondrial transcription ... Abcam, Cambridge, MA, USA), Pol-c (1 : 50 0; Santa Cruz Biotechnology), and FEBS Journal 278 (2 011 ) 250 0–2 51 0 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 250 7 Accumulation of mtDNA deletions ... 0.46%) (P < 0. 05) (Fig 1) Moreover, the deletion burden in the high-dose d-Gal group was FEBS Journal 278 (2 011 ) 250 0–2 51 0 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 25 01 Accumulation...

Ngày tải lên: 14/03/2014, 23:20