neuroradiology as a tool in neuropathologic diagnosis of intracranial masses

Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx

Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx

... structures in lignins by cleavage of arylglycerol-β-aryl ether bonds As a single method, thioacidolyse has a definite advantage in that it may be used to characterize unambiguously typical and prominent ... contain information about all chemical constituents of organic material This advantage eliminates the need to initially pinpoint the key factor that determines a specific characteristic NIRS instruments ... for screening (for example in plant breeding), values of and upward are suitable for quality control analysis, and values of above are excellent, and can be used in any analytical situation RESULTS...

Ngày tải lên: 08/08/2014, 14:20

12 316 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using ... wavelengths and was recorded in green Ultrastructural localization of Ca2+ Ca2+ localization was cytochemically analyzed in pistil tissues by using the pyroantimonate method of Rodríguez-Garcia and Stockert ... Trewavas AJ: Imaging and measurement of cytosolic free calcium in plant and fungal cells J Microsc 1992, 166:57-86 26 Webb AAR, McAinsh MR, Taylor JE, Hetherington AM: Calcium ions as intracellular...

Ngày tải lên: 11/08/2014, 11:21

12 529 0
Báo cáo khoa học: " Geographical Information System (GIS) as a Tool in Surveillance and Monitoring of Animal Diseases" potx

Báo cáo khoa học: " Geographical Information System (GIS) as a Tool in Surveillance and Monitoring of Animal Diseases" potx

... string of such co-ordinates A polygon is a closed line The grid-based format of data is captured as information of each quadratic cell in a screen and could be looked at as a photo of the area ... provide maps which show the spread of the disease by displaying the maps as a movie The GIS can also be incorporated in a real time outbreak notification, as done in an eradication program of the Aujeszky’s ... the case farm and all farms at risk within a specified area of the outbreak Buffer zones can be drawn around those farms as shown in Fig and with a link to tables of the addresses of the farms at...

Ngày tải lên: 12/08/2014, 15:20

7 341 0
báo cáo khoa học: "Dermatofibrosarcoma presenting as a nodule in the breast of a 75-year-old woman: a case report" pps

báo cáo khoa học: "Dermatofibrosarcoma presenting as a nodule in the breast of a 75-year-old woman: a case report" pps

... with a mass in her left breast 21 years after being diagnosed with invasive ductal carcinoma of the right breast, treated by a right mastectomy and axillary dissection followed by radiotherapy and ... Based on imaging, the diagnosis was a probable angiosarcoma Due to the presence of a pacemaker for cardiac arrhythmia and full anticoagulation therapy for a pulmonary embolism, magnetic resonance ... hypertension, a pacemaker for cardiac arrhythmia and was also treated with acenocoumarol for a pulmonary embolism two years ago Magnetic resonance imaging (MRI) was not feasible due to the pacemaker We...

Ngày tải lên: 10/08/2014, 23:20

8 295 0
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx

Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx

... 51(12):2333-2340 Okamoto M, Kawabe T, Iwasaki Y, Hara T, Hashimoto N, Imaizumi K, Hasegawa Y, Shimokata K: Evaluation of interferon-gamma, interferon-gamma-inducing cytokines, and interferongamma-inducible ... surface causing a change in the levels of the surface plasmon signals Analysis of this change enables determination of both kinetic and analyte concentrations More recently SPR has emerged as a ... molecular fingerprint is analysed, would increase the accuracy of disease diagnosis, aid earlier disease detection, allow for improved clarification of disease subtypes and allow automation for...

Ngày tải lên: 12/08/2014, 14:20

17 377 0
INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY

INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY

... Endonucleases can be classified into two classes: Class I AP Endonucleases Class I AP endonucleases are also known as AP Lyases (or β-lyases) as they process the AP sites by the β-elimination reaction, ... functioning, altered or elevated levels of Ape1 have been observed in a variety of cancers including breast cancer, gliomas, sarcomas (osteosarcomas, rhabdomyosarcomas), ovarian and multiple myeloma ... - AR02 and AR06 103 AR03 can act as a single agent against human cancer cells 104 Inhibition of Ape1 in SF767 glioblastoma cells by AR03 results in an increase of unrepaired AP...

Ngày tải lên: 24/08/2014, 13:10

156 218 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... close to (Clas % and Clas % 0) as can be inferred from the primary data However, it is interesting that a slight reduction in las activity resulted in a very strong decrease in growth rate and glycolytic ... dehydrogenase and 0.3 U aldolase PK was assayed as described by Crow and Pritchard [30] Final concentrations in assay was: mm GDP, mm PEP, mm fructose 1,6-bisphosphate, 10 mm MgCl2, 0.2 mm NADH and...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of them are introduced as follows.  ... pond  area  in the  province. As shown in Fig. 2, the total area of brackish  water  shrimp  culture  has  increased  approximately 4 times, from 251 ha in 2000 to  902.5  ha  in 2007.  According  ... local  farmers  and  authorities  have  been  facing  some problems such as water pollution, salinity  intrusion and the spread of shrimp’s diseases.  In order to have feasible sets of measures ...

Ngày tải lên: 22/03/2014, 12:20

13 488 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

... staff of an ambulant out-patient care unit in Essen, attendants of a meeting on "Spirituality and Medicine" in Berlin, a Caritas congress in Kevealer, and a meeting of contemporary Christian songwriters ... P sub-scales, such as age, sex, marital status, educational level, religious affiliation, SpR attitude, disease and duration of disease Using the method of univariate analyses of variance we ... value in measuring SpR attitudes and engagement of patients coping with life-threatening illness, and in the measurement of distinct aspects of QoL An advantage of our instruments is the clear-cut...

Ngày tải lên: 20/06/2014, 15:20

11 425 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

... this article as: Ramsay et al.: Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care Implementation ... doctor, a score for each construct in the TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales ... measurement of serum ferritin in the assessment of microcytic anaemia (ferritin), the measurement of serum follicle stimulating hormone (FSH) in the assessment of menopausal status, and the measurement...

Ngày tải lên: 10/08/2014, 10:23

9 368 0
Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

... A, Almaraz A, Prado A, Purıfıcacıo M, Gutıerrez N, Garc a- Pascual A, Duen A, Cuervo M, Abad R, Herna´Ndez B, Lorenzo B, Bratos AM, Rodrıguez Torres A Evaluation of an immunocapture-agglutination ... Solerab J Evaluation of Brucellacapt for the diagnosis of human brucellosis Journal of Infection 2004; 49: 102–108 Clavijo E, Diaz R, Anguita A, Garcia A, Pinedo A, Smith HL Comparison of a Dipstick ... one another was investigated statistically In a comparative study conducted by Prado et al (6), immuncapture agglutination test (Brucellacapt), SAT and Coombs anti-Brucella test were compared...

Ngày tải lên: 25/10/2012, 10:56

5 605 0
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

... sputa was performed All clinical and laboratory testing was part of routine examination For HIV testing, specific informed consent was asked and counseling offered Approval for this study was ... all findings, and comparing this probability with the therapeutical threshold LCA as such has no direct role in patient-by-patient clinical case management of TB, but it expands our toolbox in ... class analysis in medical diagnosis Stat Med 1986; 5: 21-27 Formann AK, Kohlmann T Latent class analysis in medical research Stat Methods Med Res 1996; 5: 179-211 Bajani MD, Ashford DA, Bragg...

Ngày tải lên: 22/03/2014, 18:20

7 506 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

... carrying out a conversation and had been residing in the NHs for at least months We defined mentally intact as having a Clinical Dementia Rating (CDR) ≤ 0.5 [22], which was assessed by trained nurses ... occupational therapy and participation in the political, cultural and religious arenas In this way, health care professionals can encourage the residents to engage in activities in the NH and in activities ... by providing health care information and health care in a consistent way Manageability could be enhanced by having family and health care professionals provide resources such as social support...

Ngày tải lên: 18/06/2014, 19:20

9 845 0
báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc

báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc

... clusters of retained items within each of the 14 individual domains and then on the resultant item pool in its entirety after item elimination at the domain level In Rasch analysis, a mathematical ... Baseline characteristics Table displays baseline demographic and disease parameters (including ATAQ-IPF scores) for the study sample The mean time from diagnosis to questionnaire completion was ... domain except Therapies On balance, internal consistency reliability of the domains and overall instrument was excellent, and Rasch model reliability of person separation was good (Table 2) All...

Ngày tải lên: 20/06/2014, 16:20

9 719 0
Báo cáo lâm nghiệp: "Diagnosing plant water status as a tool for quantifying water stress on a regional basis in Mediterranean drylands" pdf

Báo cáo lâm nghiệp: "Diagnosing plant water status as a tool for quantifying water stress on a regional basis in Mediterranean drylands" pdf

... performed in September 1998, with the aim of estimating the maximum annual impact of water stress in areas at different levels of landscape degradation a Istanbul Ankara Bursa Izmir Antalya Adana c ... considered as suitable candidates to natural reforestation of degraded areas of the Mediterranean Basin region Moreover, Carob tree is a species of increasing economic interest for industrial use of ... maintain relatively high RWC even in the warmest hours of the day so that Ψmin was buffered to relatively constant values A typical water spender is defined as a species capable of maintaining...

Ngày tải lên: 09/08/2014, 04:20

13 292 0
Báo cáo y học: "Ultrasound in the diagnosis of a median neuropathy in the forearm: case report" doc

Báo cáo y học: "Ultrasound in the diagnosis of a median neuropathy in the forearm: case report" doc

... anatomic abnormalities [3,5] This case demonstrates that it may be valuable in establishing an anatomic etiology and directing appropriate management in a diagnostically challenging case of median ... subsequent healing It has been shown that HRUS may be used as an adjunct to physical examination and electrodiagnostic findings in the diagnosis of nerve entrapment neuropathies in the absence of anatomic ... neuropathy in the forearm In addition, ultrasound is non-invasive, inexpensive, and effective as a pre-operative planning tool for the surgical treatment of focal neuropathies Page of (page number...

Ngày tải lên: 10/08/2014, 10:20

4 372 0
báo cáo khoa học: "IsoBED: a tool for automatic calculation of biologically equivalent fractionation schedules in radiotherapy using IMRT with a simultaneous integrated boost (SIB) technique" ppt

báo cáo khoa học: "IsoBED: a tool for automatic calculation of biologically equivalent fractionation schedules in radiotherapy using IMRT with a simultaneous integrated boost (SIB) technique" ppt

... Conception and design: VB, MB and LS Development of software: VB and MP Analysis and interpretation of the data using IsoBED: AA, LS, MP and VB Drafting of the manuscript: VB, AA, MB and LS Final approval ... software permits a comparison of the biologically equivalent schedules using hyper/hypo-fractionated as well as conventional regimes It also includes a database with the main DV- constraints at ... Soriani A, Benassi M, Arcangeli G, Giovinazzo G, Benassi M, Marucci L: Analysis of salivary flow and dosevolume modeling of complication incidence in patients with head-andneck cancer receiving intensity-modulated...

Ngày tải lên: 10/08/2014, 10:21

11 402 0
báo cáo khoa học: "Contribution of magnetic resonance imaging in the diagnosis of talus skip metastases of Ewing’s sarcoma of the calcaneus in a child: a case report" pdf

báo cáo khoa học: "Contribution of magnetic resonance imaging in the diagnosis of talus skip metastases of Ewing’s sarcoma of the calcaneus in a child: a case report" pdf

... this article as: Jalal et al.: Contribution of magnetic resonance imaging in the diagnosis of talus skip metastases of Ewing’s sarcoma of the calcaneus in a child: a case report Journal of Medical ... YS, Zahid M, Sabir AB, Asif N, Kumar G, Akhtar M: Calcaneal Ewing’s sarcoma with skip metastases to the adjacent tarsal bones J Clin Diag Res 2011, 5:117-119 Sandrasagra FA: Ewing’s sarcoma of ... diagnosis Our patient remained disease-free for six months after diagnosis Based on these findings, a diagnosis of Ewing’s sarcoma of the calcaneus was made Discussion Ewing’s sarcoma is a rare...

Ngày tải lên: 10/08/2014, 23:20

4 404 1
w