... Proteins In this study, soluble proteins concentrations in AM- inoculated maize roots increased was higher than uninoculated plants These proteins may play a role in acquisition and assimilation ... (Glomus intraradices) inoculated plants with the interaction effect of zinc at various levels compared to other AM fungus species inoculated plants There are reports pointing out that PPO is prominent ... nutritional status in roots and shoots of inoculated and non-inoculated maize plants exposed to varying levels of Zn The progressive physiological changes in host plant were assessed at 45 and 75 days
Ngày tải lên: 04/11/2020, 21:57
... to improve neonatal outcomes and reduce neonatal morbidity and mortality by preventing hypothermia, and by keeping other vital signs stable through skin to skin contact and providing benefits of ... developing countries where incubation care is not sufficient, KMC has been well appreciated Kangaroo mother care is defined as having four components: early, continuous and prolonged skin to skin ... between preterm baby and the mother, exclusive breast feeding, early discharge after hospitals initiated KMC with continuation at home and close follow up at home [6].Kangaroo mother care was found
Ngày tải lên: 15/08/2017, 15:10
DSpace at VNU: Contamination by arsenic and other trace elements in tube-well water and its risk assessment to humans in Hanoi, Vietnam
... (a) and barium (b) in groundwater, rainwater and pond water in the suburban areas of Hanoi Sample number of groundwater (F01-14, F21-31) indicates well in each home 3.5 Contamination status of other ... understand the magnitude of As contamination, concentrations of As in groundwater in the present study were compared with those in other As-contaminated 98 Table Concentrations of arsenic and other ... values in groundwater in Gia Lam and Thanh Tri were lower than those in other Ascontaminated areas However, the maximum value (330 mg/l) was comparable to the levels in other Ascontaminated areas In
Ngày tải lên: 16/12/2017, 04:53
Thinking and discussing at higher levels in the literacy block
... actively, giving them a purpose for their reading that prompts integration of information This active stance supports students as they think about the text in sophisticated ways and begin practicing the ... ultimate goal of guided reading is to help children learn how to use independent reading strategies successfully." -Fountas and Pinnell Purpose of Reading Print Reading Read & Story Understand ... practicing the thinking work we want them to habituate and carry into the rest of their lives” (Preventing Misguided Reading, p.76) A Where is Your Level of Thinking? Lower vs Higher Level Thinking Revised
Ngày tải lên: 30/11/2018, 18:32
Zircon record of fractionation hydrous partial melting and thermal gradients at different depths in oceanic crust odp site 735b south west indian ocean
... veins modified after Robinson et al (2002) and Mg number in primitive gabbro modified after Natland and Dick (2002a) The remaining profiles show data obtained in this study c-d) δ18O and ɛHf in ... some elements, in this case in P, Ce, U and Th as well as Nb and Ta Apatite is a common P-bearing mineral in Site 735B (Meurer and Natland 2001) and may also be enriched in Ce, U and Th Therefore, ... redistribute within the crust Such melts are saturated in accessory minerals, such as zircon, titanite and apatite, and often zircon is the only remaining phase that preserves magmatic composition and records
Ngày tải lên: 15/03/2023, 20:04
Today, translating English terms is critical to the process of custom operations in development society. Furthermore, it aids management agencies at all levels in formulating short and longterm future development directions. In addition, translating Engli
... with China, Laos, and Cambodia with many official border gates and trails and openings in complex natural terrain conditions, cross-border trade relations are increasingly developing, and cross-border ... been increasingly affirmed, especially in the current international economic integration conditions Customs has the task of being the frontline unit of the border, facilitating and implementing ... facilitation for international trade activities, while observing and complying with the provisions of law and ensuring security and national economic interests After 75 years of construction and
Ngày tải lên: 12/10/2023, 13:25
Báo cáo y học: "Integrative analysis for finding genes and networks involved in diabetes and other complex diseases" ppt
... idea and protocol formation: RB and FP Data mining and decision tree analyses: MA, RB and FP Analysis and interpretation of gene-gene interaction data: RB, MA and FP Development of integrative ... acknowledge Olga Rigina for maintaining and updating the protein interaction data warehouse at CBS and Tianshun Ye for contributing to the development of the protein interaction scoring system 18 19 ... RNA-regulating factor) Nucleotide binding, RNA binding, mRNA processing BAT1 [6p21.33] Spliceosome RNA helicase BAT1 (HLA-B associated transcript-1) Nucleotide binding, nucleic acid binding, ATPdependent
Ngày tải lên: 14/08/2014, 08:20
Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx
... estimates of Reynolds distance and standard errors were computed between the G2 population and lines in G11, and across lines in G11, using the POPULATIONS programme [19] In order to assess the in? ??uence ... was the control line, in which the parents were chosen at random Within each line and at each generation (one generation per year), 15 males and 30 females out of about 100 candidates of each sex ... is involved in different stages of the immune response [22] Could this indicate that variations of markers that in? ??uence ND3 or PHA traits are maintained by balancing selection, like variations
Ngày tải lên: 14/08/2014, 13:21
Writing a literature review in psychology and other majors
... the family, and particularly the mother, in this relationship In addition, Kaminsky and Dewey (2001) found that the autism-sibling relationship is characterized by less intimacy and prosocial ... & Outlining Create a topic outline before you begin drafting In your literature review’s Introduction: Identify the topic Establish the topic’s importance Define any crucial terms Engage in any ... useful, if your professor allows Internet research (Dr Fox: No Internet Web sites!) Evaluating & Interpreting Research Ensure your information is both accurate and unbiased Stick to peer reviewed
Ngày tải lên: 01/12/2016, 22:44
Plate buckling in bridges and other structures
... Cataloguing in Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloging in Publication Data Å kesson, B (Bjorn) Plate buckling in ... Plate Buckling in Bridges and other Structures Plate Buckling in Bridges and other Structures Björn Åkesson Consulting Engineer, Fagersta, Sweden LONDON / LEIDEN / NEW YORK / PHILADELPHIA / SINGAPORE ... of Structural Engineering and Bridge Engineering at Chalmers University of Technology in Göteborg, Sweden My focus as a researcher was in the beginning concentrated on the fatigue life of riveted
Ngày tải lên: 01/08/2017, 14:26
Volume 1 photovoltaic solar energy 1 06 – feed in tariffs and other support mechanisms for solar PV promotion
... for planning and executing Singapore’s strategy to become a clean energy hub It was created in April 2007 to coordinate various research and test-bedding programs, including those of the National ... Consumption-related costs • Cleaning and maintenance costs • Personnel requirement • Insurance and administration • Other variable ancillary costs (e.g lubricating oil) • Unforeseen costs • Etc Operating and ... factored in when calculating FITs in Germany (see above) Regarding the fact the inflation rate in Germany has been in this range and stable over decades, this is a feasible alternative to indexing
Ngày tải lên: 30/12/2017, 12:54
The coming collapse of the dollar and how to profit from it make a fortune by investing in gold and other hard assets
... undoing, how homeowners are overborrowing, how innovations like securitization and mortgage REITs are leading us to ruin, the relationship between stock prices and inflation, and the changing ... envisions dramatic changes in both the global financial system and the lives of ordinary people Because what we’re covering isn’t what you hear on the evening news and read in the daily paper? ?at least ... Washington policy makers and Wall Street money managers, and their thinking determines what the rest of us are told Economic growth, job creation, and stock prices thus dominate the evening news,
Ngày tải lên: 20/06/2018, 16:50
Porco, alessandro augustine in carthage and other poems
... permission of the copyright owners and ECW Press library and archives canada cataloguing in publication Porco, Alessandro Augustine in Carthage and other poems / Alessandro Porco “a misFit book.” isbn ... Printing: Coach House Printing The publication of Augustine in Carthage has been generously supported by the Canada Council for the Arts, which last year invested $20.1 million in writing and ... ST I N E IN C ARTHAGE And Other Poems ALESSANDRO PORCO P O R C O Augustine in Car thage and Other Poems ECW AU G U ST I N E IN CARTHAGE An d O t h e r Po e m s ECW Copyright © Alessandro Porco,
Ngày tải lên: 25/02/2019, 17:14
Master Thesis in Economics: Evaluation of Selected Value at Risk Approaches in Normal and Extreme Market Conditions
... International Accounting and Finance at Dublin Business School August 2014 Submitted and written by Felix Goldbrunner 1737701 Declaration: I declare that all the work in this dissertation is entirely ... management in financial institutions such as banks and hedge funds as well as other financial-service providers Since this thesis aims also to explain the various value at risk approaches in a generally ... Evaluation of Selected Value -at- Risk Approaches in Normal and Extreme Market Conditions Dissertation submitted in part fulfilment of the requirements for the degree of Master of Science in International
Ngày tải lên: 09/01/2020, 17:49
báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx
... which pathway is used during AtTSPO relocation during salt-stress However our data indicate that AtTSPO changes its localization during stress, and that it is also possible that the mitochondrial ... localization of AtTSPO fusion proteins For the GFP fusion constructs, clones containing the coding region of AtTSPO as well as fusions starting at methionine 21 and 42 were generated and cloned into ... cloning and genotyping PRIMER NAME FOR GENOTYPING AND CLONING SEQUENCE AtTSPO LP agagcaaatcgcatcagcgtc AtTSPO RP ggaacgtaaccggatcccaaa LBa1 tggttcacgtagtgggccatcg TSPO NT1 aaaaagcaggctccatggattctcaggaca...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo sinh học: "Non-additive effects of RBP4, ESR1 and IGF2 polymorphisms on litter size at different parities in a Chinese-European porcine line" pot
... RBP4 sequencing and pyrosequencing This table shows primers used for RBP4 sequencing and pyrosequencing Annealing temperature, MgCl2 concentration and amplification size are indicated for each ... maternal imprinting: used in the analysis of IGF2 SNP Two association analyses were performed fitting the paternal imprinting effects Additive and dominant effects were included in the first ... equivalent to comparing haplotype TGAC to haplotypes GAAG and GATG Individual and joint association analy- Table 4: Individual and joint analysis of RBP4-MspI and ESR1-PvuI effects on NBA12 and NBA3+ a...
Ngày tải lên: 14/08/2014, 13:21
RENOVATING ORGANIZATIONAL STRUCTURE AND OPERATION OF PEOPLE’S COMMITTEE AT ALL LEVELS IN CONTEMPORARY VIETNAM
... to continuing renovation of organizational structure and operation of people’s committee at all levels 4.2.1 Innovation of awareness and great political commitment in renovating organizational ... corruption that was disorting the operation of the state administration 4.2.4 Strengthening renovating operation of People’s committee at all levels 22 organizational structure and - Renovating the ... People’s Committee at all levels relations involving the relationship between the state administration system and People’s Council and with other agencies and organizations in the political system...
Ngày tải lên: 18/05/2016, 07:42
Cadmium and lead contents in rice and other cereal
... determination and indium In and thallium ŽTl as internal standards, preparation of calibration curves and other analytical conditions are shown in Table The recovery was approximately 95 and 97% ... multiplication of daily consumption with Cd and Pb contents in the cereals Both data on the rice and wheat consumption ŽMinistry of Health and Welfare, 2000 and that on Cd and Pb contents in rice and ... S, Watanabe T, Nakatsuka H, Matsuda-Inoguchi N, Higashikawa K, Ikeda M Further reduction in lead exposure in women in general populations in Japan in the 1990s, and comparison with levels in east...
Ngày tải lên: 15/03/2014, 23:22
harvard university press good natured the origins of right and wrong in humans and other animals mar 1996
... Printed in the United States of America Seventh printing, 2003 Library of Congress Cataloging -in- Publication Data Waal, F B M de (Frans B M.), Good Natured : the origins of right and wrong in ... following page 24 Sympathy 40 Warm Blood in Cold Waters Special Treatment of the Handicapped Responses to Injury and Death Having Broad Nails The Social Mirror Lying and Aping Apes Simian Sympathy ... the imagination and sometimes hint at striking capacities, yet cannot demonstrate them Only repeated observations and solid data allow us to compare alternative hypotheses and arrive at firm...
Ngày tải lên: 11/06/2014, 14:58
báo cáo hóa học:" Change in condom and other barrier method use during and after an HIV prevention trial in Zimbabwe" potx
... consisting of: pre-test and post-test counselling about HIV and STIs; testing and treatment of curable STIs; and intensive risk-reduction counselling that included education, demonstration and promotion ... randomization, women in the diaphragm group received education and counselling about the diaphragm and a product instruction sheet HIV/STI testing and counselling and risk-reduction counselling were ... experience, along with ongoing support, may better ensure uptake and continued use Previous reports from other developing countries indicate that adequate information and support, as well as good...
Ngày tải lên: 20/06/2014, 08:20