naturaljava a natural language interface for programming in java

... and Seman- tics of the Japanese Language Engine", forth- coming. In Mazuka, R., and N. Nagai, Eds. Japanese Syntactic Processing, Hillsdale, NJ: Lawrence Erlbaum Associates. Kay, M. ... as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a modifier of song. Pereira's goal ... grammatical category plays a spe- cial role in the typing scheme of Gemini. For each category, Gemini makes a set of declarations stipu- lating its allowable features and the relevant value...

Ngày tải lên: 20/02/2014, 21:20

... Abstract In contrast to the latest progress in speech recognition, the state-of-the-art in natural language generation for spoken language dialog systems is lagging behind. The core dialog ... Proceedings of the ACL Student Research Workshop, pages 61–66, Ann Arbor, Michigan, June 2005. c 2005 Association for Computational Linguistics Towards an Optimal Lexicalization in a Natural- Sounding ... follows: ã You can buy a tent at Camping World. ã You can purchase a tent at Camping World. ã You can get a tent at Camping World. ã You can acquire a tent at Camping World. ã Camping World sells...

Ngày tải lên: 17/03/2014, 06:20

... Martin et. al. [12] define a transportable NL interface as one that can acquire a new domain model by interacting with a human database expert. Although DATALOG does not yet have such a ... Bates, M. and Bobrow, R. J., "Information Retrieval Using a Transportable Natural Lan- guage Interface. " In Research and Development in Information Retrieval: Proc. Sixth Annual ... Lab- oratories, Warren MI (1984). 7. Grosz, B. J., "TEAM: A Transportable Natural Language Interface System." In Proc. Conf. on Applied Natural Language Processing, Santa Monica...

Ngày tải lên: 17/03/2014, 19:21

... NL Engine Natural language processing in the Unisys natural language understanding (NLU) system (Dahl, Norton and Scholz (1998), Dahl (1992)) is done by a natural language (NL) engine with ... such information for additional words manually. Since the core vocabulary of 3000 words is insufficient for any real application, manual development could be a substantial task. Our linguistic ... (WordNet-based KB concept names from ISI see text) 984 Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System Lewis M. Norton, Deborah A. Dahl, Li Li, and Katharine...

Ngày tải lên: 20/02/2014, 18:20

... eliminate arbitrariness. Rather, a definition of representative corpus must take into account tile research goals pursued. For a natural language system which is sup- posed to analyze and ... to formulate all of these typcs of rules in natural language for B3 trying to stay within at least tile vocabulary of B, , to add lhe words used in the fommlations to the original set, and ... here allows for a balanced extension of this very smaU core. The list//3 was chosen as the statistical core vocabulary serving as a base for applying se- mantic criteria, becat, se the overall...

Ngày tải lên: 22/02/2014, 10:20

... 2006. c 2006 Association for Computational Linguistics A Flexible Approach to Natural Language Generation for Disabled Children Pradipta Biswas School of Information Technology Indian Institute ... Kharagpur 721302 INDIA pbiswas@sit.iitkgp.ernet .in Abstract Natural Language Generation (NLG) is a way to automatically realize a correct ex- pression in response to a communicative goal. ... uses a tree structured template organization that re- sembles Tag Adjoining Grammar (TAG) struc- ture. The template-based approach that has been taken in the system, enables the basic language...

Ngày tải lên: 17/03/2014, 04:20

... Center SRI International and Center for the Study of Language and Information Stanford University Abstract A sophisticated natural language system requires a large knowledge base. A methodology ... well-known that the interpretation of natural language discourse can require arbitrarily detailed world knowledge and that a sophisticated natural language sys- tem must have a large knowledge base. ... been encoded in ways Ihat are indel)endent of domain and hence should be useful for any natural language application. Of particular interest here is the klentification and axiomatization of the...

Ngày tải lên: 17/03/2014, 19:21

Ngày tải lên: 24/03/2014, 05:21

Ngày tải lên: 31/03/2014, 03:20

Ngày tải lên: 19/03/2015, 14:46

... Recognition Evaluation database. 1 Introduction Spoken language and written language are similar in many ways. Therefore, much of the research in spoken language identification, LID, has been in- spired ... of the ACL, pages 515–522, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics A Phonotactic Language Model for Spoken Language Identification Haizhou Li and Bin Ma Institute ... per- formance of the proposed bag-of-sounds frame- work using the 1996 NIST Language Recognition Evaluation (LRE) data. The database was intended to establish a baseline of performance capability...

Ngày tải lên: 20/02/2014, 15:20

... and aspiration) from those that are relatively invariant to context (e.g., place, manner and voicing). 2 In the past, the emphasis has been on invariants; allophonic variation is traditionally ... as: 3 ( 8a) /h/is always syllable initial, phonotactic (8b) [1" I is always syllable final, allophonic (8c) [?] is always syllable final, and allophonie (Sd) [t h] is always syllable ... defining a homorganic nasal cluster to be a nasal cluster ]0. I personally hold a much more controversial posution, that tinite state grammars are sufficient for most. if not nil, natural language...

Ngày tải lên: 21/02/2014, 20:20

... represents a relationship to another class using a $class facet and mapping information to the database schema using a Sstorage facet. The value of a Sstorage facet denotes the class name which has ... 43-2, Information Processing Society of Japan, 1984 [in Japanese]. Makinouchi, A. et al., Relational Databese Management System RDB/VI, Transactions of Information Processing Society of Japan, ... Mathematical Engineering Section, University of Tokyo, 1981. Ginsparg, J. M., A Robust Portable Natural Language Data Base Interface, Proc. Conf. Applied Natural Language Processing, 1983, pp.25-30....

Ngày tải lên: 09/03/2014, 01:20

... with machine learning algorithms that perform classification, clustering and pattern induction tasks. ã Having a good annotation scheme and accurate annotations are critical for machine learning ... as corpora, and a single set of data annotated the same way is called an annotated corpus. Annotated corpora can be used for training machine learning algorithms. In this chapter we will define ... tags that will concern us when annotating natural language data: consuming and non-consuming tags. A consuming tag refers to a meta- data tag that has real content from the dataset associated with...

Ngày tải lên: 15/03/2014, 16:20

... Akt substrate regulating GLUT4 translocation, has a func- tional Rab GTPase-activating protein domain. Biochem J 391, 87–93. 11 Larance M, Ramm G, Stockli J, van Dam EM, Winata S, Wasinger V, ... Activated phosphatidylinositol 3-kinase is sufficient to mediate actin rearrangement and GLUT4 translocation in 3T3-L1 adipocytes. J Biol Chem 271, 17605–17608. 8 Okada T, Kawano Y, Sakakibara ... adipocyte protein with a Rab GTPase-activating protein (GAP) domain. J Biol Chem 277, 22115–22118. 10 Miinea CP, Sano H, Kane S, Sano E, Fukuda M, Pera- nen J, Lane WS & Lienhard GE (2005) AS160, the Akt substrate...

Ngày tải lên: 16/03/2014, 06:20

... GACTGCAaCCCCAAAtCGGACAG 2b+ CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC 2 G GAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC 3+ wt GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC 3+ YIRN GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG 3– ... G GAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC 3+ wt GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC 3+ YIRN GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG 3– GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG Ó FEBS 2003 A novel CaM-binding site found in ammodytoxin A (Eur. J. ... expression plasmids. Primer Sequence (5Â to 3Â end) 1+ TAATACGACTCACTATAGGGAGACCACAACGGTTTCC 1 GGGC aagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG 2+ GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTGCAaCCCCAAAtCGGACAG 2b+...

Ngày tải lên: 17/03/2014, 03:20

Ngày tải lên: 19/03/2014, 07:20

Ngày tải lên: 24/03/2014, 05:21

Ngày tải lên: 31/03/2014, 03:20

Ngày tải lên: 30/05/2014, 00:26