... CD3 +cells in the analyzed samples Furthermore, we analyzed sjTRECs in sorted CD4+ and CD8+ T cells This is the most sensitive and accurate method for quantitation of naïve T- cells It allows also the comparison ... cloned in to the EcoRV restriction site of the TOPO TA Vector (Invitrogen, Groning, The Netherlands) Based on the DNA concentration, measured by spectrophotometry and confirmed by a quantitative gel ... Germany) After CD4+ and CD8+ T cells sorting, the purity was determined by indirect immune fluorescent analysis The positive cells were around 95% to 97% DNA extraction Total DNA from distinct cell...
Ngày tải lên: 18/06/2014, 16:20
... to the intermediate expression of CD38 on naïve CD4+ T cells, but this was not confirmed as this study did not differentiate between naïve and memory CD4+ T cells On CD8+ T cells, significant ... CD4+ T cells Composite dot scan patterns of antibody binding for CD4+ T cells Half of a duplicate array was shown with the alignment dots "A" at left, top and bottom Alignment dots are a mixture ... findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those from other HIV+ individuals CD16 expression on CD8+ T cells in...
Ngày tải lên: 13/08/2014, 05:22
Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot
... not recognize endogenous Glut-1 on these cells Notably, the ability of HTLV-1 and HTLV-2 derived RBDs to bind to parental and transfected 29 3T cells correlated with the data obtained using the ... quiescent CD8 T cells, these results indicate that the cognate antigen of mAb1418 is not a member of the glucose transporter family http://www.retrovirology.com/content/4/1/31 To further assess whether ... activated CD4 T cells by greater than 90% (Figs 4B and 4C) Altogether, the data reported here show that surface Glut-1 as well as subsequent transporter function is upregulated on both CD4 and...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt
... showed a strong correlation with tumor response to CRT, indicating that tumors attracting T cells are more liable to respond to CRT Many previous reports have suggested that a high number of TIL in ... chemotherapy [17] However, in our literature search, there are no report to evaluate the correlation between TIL and radiosensitivity, and this is the first one to show the direct link between the ... density of T cells infiltrating in solid tumor and response to CRT On the other hand, Grabenbauer et al previously reported that tumor-infiltrating CD3(+) T cells, especially granzymeB(+) CD8( +) T...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMB2 NM_002794.3 proteasome subunit, beta type, PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga ... V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology ... C1QCL aaggatgggtacgacggact C1QCR ttctgccctttgggtcct VIRvsLTNP CD4 7.3 4.4 SERPING1L ctccttacccaggtcctgct SERPING1R ggatgctctccaggtttgtt VIRvsLTNP CD4 5.3 2.8 SERPING1 NM_000062.2 serpin peptidase...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx
... on CD4+ CD45RO+ and CD8 +CD45 RO+ and also on CD4+ CD45RA+ and CD8 +CD45 RA+ T cells indicates activation and the potential to respond to chemotactic gradients in inflammatory areas, which is consistent ... reported to distinguish effector cells from naive T cells within the CD8 +CD45 RA+ T cell population [21] However, Wills et al [22] demonstrated that cytomegalovirus-specific T cells, that is, antigen-experienced ... infection and interferon-α therapy [33] The present study shows that not only ‘classical’ chemokine-receptor-bearing CD45 RO+ T cells, but also CD45 RA+ ‘revertants’ within the CD4+ and CD8+ T cell...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Antigen and Memory CD8 T Cells: Were They Both Right" ppsx
... peripheral tissue to isolate CD8 TEF cells The identification of central and effector memory Tcell subsets finally lays to rest an interesting historical debate that raged in the literature without reconciliation ... proliferation and cytokine production) to that of T cells that have encountered Ag Although the number of Agspecific CD8 T cells was likely to have expanded by homeostatic proliferation, homeostatic ... protected from subsequent intravenous challenge, which would direct the virus to the central compartment Both groups transferred CD8 TCM cells, and for this reason they agreed that CD8 memory cells...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt
... control group (P > 0.9, by Student’s t- test), between the age of the SLE patient group and the corresponding healthy control group (P > 0.9, by Student’s t- test), and between the RA patient group ... suggested that the differentiation may not be linear at all The central and effector memory phenotypes of CD4+ and CD8+ T cells in peripheral blood of RA patients are unknown Determination of these ... may not be due to a reduction in TRECs in naïve cells but rather to reduced TRECs in the CD45 RA +CD45 RO–CD62L– effector memory CD4+ T cells It should be noted that previous studies have reported...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps
... study contributes to our understanding of recruitment of T cells to the joint in inflammatory arthritis and suggests that in the microenvironment of the joint, dysregulation of functional patterns ... correlates with recent reports that CCL5 secretion from memory and effector CD8+ T cells is from stored granules, thought to be distinct from lysosomal secretory granules, and that this secretion of ... synovial T cells, and that this can be rapidly released without new protein synthesis on stimulation We have also demonstrated that several of the features of this inflammatory T cell population within...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " Expansion of CD4+CD25+ helper T cells without regulatory function in smoking and COPD" potx
... phycoerytrin (PE) conjugated anti-human FoxP3 was used in the same test tube The percentage FoxP3 was determined out of gated CD3+ and CD4+ lymphocytes Statistical analysis Flow cytometry data were ... into a cytotoxic phenotype This further supports a potential involvement of the acquired immune response in the pathogenesis of COPD To further evaluate the role of regulatory T cells in COPD and ... like to thank Ann-Britt Lundström, Elisabeth Åslund, Annika Johansson, Helena Tjällgren-Bogseth and Frida Holmström for their contribution to the project Author details Dept of Public Health and...
Ngày tải lên: 12/08/2014, 13:22
Báo cáo y học: "The relationship between CD4+CD25+CD127regulatory T cells and inflammatory response and outcome during shock states" potx
... between the two groups of patients (Figures 1b and 1c) At day seven, although the percentage of Tregs was higher in the septic patients than in the nonseptic patients and healthy volunteers, there ... septic shock [18] We observed that, although the percentage of NK cells was not different between patients and healthy volunteers throughout the study period, patients with shock presented with ... to deplete Tregs, we must acknowledge that anti-CD25 is not specific for Tregs and leads to the depletion of other important cells (activated T cells) Moreover, anti-CD25 antibody may not have...
Ngày tải lên: 13/08/2014, 20:21
The role of CD8 t cells in the differentiation of TNF iNOS producing dendritic cells and TH1 responses
... suggesting that CD8 T cells were vital for the polarization of Th1 cells This was also supported by studies demonstrating the involvement of CD8 T cells in the generation of protective CD4 Th1 ... promote the activation of DCs for anti-tumor effects (Fernandez et al., 1999) and viral immunity (Andrews et al., 2003) Activated NK cells produce TNF-α and IFN-γ that promotes DC maturation and Th1 ... encounter with antigen presented on DCs, CD8 T- cells proliferate and differentiate into effector T- cells These activated effector CD8 T cells express killing molecules such as Fas Ligand (FasL) and...
Ngày tải lên: 09/09/2015, 18:58
Antigen specific effector CD8 t cells regulate allergic responses via IFN y and dendritic cell function
... was studied with ex vivo culture of sorted DCs from treatment mice with either naïve or antigen-experienced CD4 T cells We found that effector OT-I, but not IFN-γ-/-OT-I CD8 T cells attenuated ... institute T- bet T- box expressed in T cells TCR T- cell receptor TGF-β Transforming growth factor beta TLR Toll-like receptor TNF-α Tumor necrosis factor α TSLP Thymic stromal lymphopoietin WT Wild ... but not Tc2 growth and CD8 T cells are capable of producing IFN-γ independent of IL-12 suggests that CD8 T cells might be biased towards the differentiation into the Tc1 phenotype (Carter and...
Ngày tải lên: 09/09/2015, 18:59
Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx
... levels of T- bet, and Itk may regulate the expression of this critical transcription factor Indeed, it has been suggested that Itk regulates T- bet levels in iNKT cells in the thymus, and that thymic ... cd T cells, the pathway restrains Given that both cell types can secrete IL-4, it is likely that the production of this cytokine, and the T- cell types that can produce it, need to be tightly ... indicates that Itk regulates the migration and homing, but not maturation and homeostasis, of these cd skin-resident intraepithelial T lymphocytes Thus Itk plays distinct roles in the development...
Ngày tải lên: 28/03/2014, 22:21
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... Biosciences) The reactivity of CD8+ T cells to WT1 or CEA or both are shown as the percentage of the total population of CD8+ T cells that were double positive (CD8+ pentamer+) Cytotoxicity assays The cytotoxicity ... particularly important for eradicating tumor cells [24] Thus, the multiple doses of vaccination may also have the potential to stimulate both CD4+ and CD8+ T cells and result in induction of antigen-specific ... In contrast, autologous DCs or the HCC cells were not able to stimulate the T cells (Figure 6A) We next examined the quality of CD4+ and CD8+ T cells from the HCC patient vaccinated by autologous...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf
... blocking antibodies conditions (Figure 2B) These results demonstrate that the elevated CD8 T cells transmigrating through the in vitro BBB in the presence of anti-PD-L1+anti-PD-L2 blocking antibodies ... vivo CD8 T cells and only low levels of PD-L1 on a small fraction of CD8 T cells (8-20%) after antiCD3+anti-CD28 activation (data not shown), this would be a less important contribution Distinct ... migration of CD8 and CD4 T cells through an in vitro BBB model HBECs were plated to the upper chamber of a Boyden chamber and then inflamed Activated CD8 (A, B) and CD4 (C, D) T cells were added to...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo y học: "CD4+CD25+ immunoregulatory T cells may not be involved in controlling autoimmune arthritis" ppsx
... essential for the homeostasis of the CD4+ CD25+ regulatory T cells that control autoimmune diabetes [6] Consistent with that report, the expression of CD4+ CD25+ regulatory T cells was found to be ... adjuvant at days 21 and 42 The incidence and severity of arthritis was determined ment As a control, the same number of CD4+ CD25– T cells, together with arthritogenic spleen cells that were depleted ... with transfer of CD4+ CD25– T cells (Fig 3a), suggesting that the CD4+ CD25+ regulatory T cells did not protect SCID mice from arthritis To further verify these results, a depletion experiment...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
... (5'-CACTGTACCAGTGCAGTAG-3') and antisense (5'-ACCATTCACACACT CGTTAT-3') primers, and using Foxp3 sense (5'-CAGCTGCCTACAGTGCCCCTAG-3') and antisense (5'CATTTGCCACGAGTGGGTAG-3') primers PCR products ... for the induction of CD4+ CD25+ regulatory T cells by conversion of CD4+ CD2 5T cells after antigen stimulation [41] We found that CD4+ CD25+ T cells obtained after coculture of CD4+ CD25- T cells and ... based on the maturation or activation state and the subset of DCs, and cytokine profiles in the microenvironment at the time of antigen uptake [1,14-16] A previous study demonstrated that CD11c+CD11b+...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "IL-2 production correlates with effector cell differentiation in HIV-specific CD8+ T cells" doc
... differentiated phenotype We tested two potential hypotheses that might explain the coexistence of these two phenomena The first hypothesis, that the less differentiated CD8+ T cells tend not to produce ... present in all of the HIV-positive subjects (Table 1) Yet, these subjects tended to have fewer CD8+ effector T cells and more cells of intermediate differentiation Thus, the differentiation of the ... on CMV tetramer-positive cells, the response to stimulation after six hours is demonstrated by the release of cytokine By isolating the tetramer-positive IFNγ+ cells, it is evident that there...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: " Nef-specific CD45RA+ CD8+ T cells secreting MIP-1β but not IFN-γ are associated with nonprogressive HIV-1 infection" ppsx
... MIRA CD8+ T cells in out of 10 PR and ART-treated patients with detectable viremia together with the analysis of a group of ART-treated patients undergoing a single cycle of TI demonstrated that ... ART-treated patients We further demonstrated on ART-treated patients undergoing single cycle TI that the presence of MIRA CD8+ T cells is independent of viral load These observations render this ... of antigenic stimulation Together with these previous studies, our data suggest that persistent stimulation by antigen can cause functional CD8+ T- cell impairment and may lead to enrichment of...
Ngày tải lên: 10/08/2014, 05:21