Anh 8 - Unit 6
... character, and encourages good citizenship and personal fitness Scouting began in England in 1907 Two years later an American businessman, William Boyce, got lost in London A boy helped him and ... explained that he was a scout crossing Atlantic SCOUT ATLANTIC This meeting led to the Scouts Association crossing the Atlantic in 1910 Although scouting is mainly for boys, there are organizations ... Question 1: When did scouting begin in England? Scouting began in England in 1907 Question 2: What led to the Scouts Association crossing the Atlantic in 1910? An American businessman, William...
Ngày tải lên: 29/05/2015, 18:00
... between day and Stata 9.0 (StataCorp, College Station, Texas) computer software was used for statistical analysis All interval data in tables and text are presented as mean with standard deviation ... Toronto, Canada Department of Anesthesia, University of California, San Francisco at San Francisco General Hospital, San Francisco California, USA Authors’ contributions RK, DM and MM generated ... mechanical ventilation Lastly, Gajic et al [18] retrospectively analyzed multiple physiologic variables on day of mechanical ventilation in a large observational trial and then validated it in two...
Ngày tải lên: 12/08/2014, 13:22
... experimental and clinical research remains to validate its potential value Conclusion Our results show that arsenic trioxide is an effective anticancer agent with potential for human gastric cancer Arsenic ... conformational change, Bax activation and up-regulation of total Bax expression involved arsenic trioxide-induced apoptosis rather than affecting total Bcl-2 expression in human gastric cancer ... may be a promising candidate for the treatment of other malignancies The combination therapy of arsenic trioxide and other chemotherapeutic agents have been applied experimentally for treatment...
Ngày tải lên: 09/08/2014, 03:21
Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf
... and that it is the b sheet A opening and the final insertion of RCL as b strand 4A that is rate limiting for latency transition Two facts complicate the interpretation of our results on the basis ... region and b strand 5A of PAI-1 and studied their effect on the transition to latent and substrate forms and on the stabilizing effect of vitronectin, a flexible joint region-binding a cofactor known ... insertion during latency transition may be affected not only through a change in the conformation of the active form, but also by a change in the conformation of a transition state with an unknown three-dimensional...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... subunit±subunit contacts between three types of interfaces (a1 b1, a1 b2 and a1 a2) of HbO2 and the corresponding COb4 interfaces As a result, they found that, in contrast to the stable b1b4 interface, ... rate suppression was decreased with increasing hydrogen ion concentration This is due to the fact that the a chain exhibits a very strong proton-catalysis not only in the separated chain but also ... proton, so that the b chains can keep a constant resistance against the acidic autoxidation, even if the HbO2 tetramer is diluted into ab dimers Indeed, this is the most characteristic feature...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Proteinase-3 as the major autoantigen of c-ANCA is strongly expressed in lung tissue of patients with Wegener’s granulomatosis" pptx
... pneumocytes, vascular endothelial cells and renal epithelial cells are no longer only innocent bystanders but active participants in inflammatory reactions Available online http://arthritis-research.com/content/4/3/220 ... found just a very weak signal in the heart and brain, and could not detect a band in liver tissue (Supplementary Fig 1) In situ hybridization for PR-3 mRNA in normal lung Nearly all PR-3 mRNA-positive ... envision that the upregulation of PR-3 in parenchymal lung tissue in patients with WG, probably through an altered cytokine pattern, can lead to PR-3/ ANCA-mediated lung damage Further in vitro...
Ngày tải lên: 09/08/2014, 03:24
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... Anneren G, Axelsson O, Nunn J, Ewald U, et al.: Fetal mesenchymal stem-cell engraftment in bone after in utero transplantation in a patient with severe osteogenesis imperfecta Transplantation ... Several international randomized trials are being launched under the auspices of the European Group for Blood and Marrow Transplantation stem cell subcommittee targeting acute GvHD treatment and ... IFN-γ on the surface of antigen-presenting cells and then converts tryptophane to kynurenine The degradation of tryptophane, as an amino acid that is essential for lymphocyte proliferation, was...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx
... protein L19-IL10 using the following primer sequences: a backward antisense primer, 5' TAATGGTGATGGTGATGGTGGTTTCGTATCTTCATTGTCATGTAGGCTTC-3'; and a forward sense primer, 5'-TTTTCCTTTTGCGGCCGCTCATTAGTTTCGTATCTTCATTGTCATGTA-3', ... 5'-TTTTCCTTTTGCGGCCGCTCATTAGTTTCGTATCTTCATTGTCATGTA-3', which appended part of a 15 amino acid linker (SSSSG)3 at its N- terminus and a stop codon and NotI restriction site at its C-terminus The gene for the single-chain ... http://arthritis-research.com/content/11/5/R142 CATGGGCTGGAGCC-3' and a forward sense primer, 5'GAGCCGGAAGAGCTACTACCCGATGAGGAAGATTTGATTTCCACCTTG-GTCCCTTG-3' Using this strategy, a HindIII restriction site was inserted at the N- terminus...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Variations in branching of the posterior cord of brachial plexus in a Kenyan population" ppsx
... dissection and collection of data Authors’ contributions MM was involved in the conception and design of the study, data collection and analysis, drafting, revision and correction of the manuscript ... SR was involved in data analysis, drafting, revision and correction of the manuscript SS was involved in conception and design of the study, data collection and analysis, drafting of the manuscript ... clinicians interpreting effects of nerve injuries to the upper limb and surgeons operating in the axilla should be aware of these patterns to ensure correct management and avoid inadvertent injury...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Sustained remission of rheumatoid arthritis with a specific serotonin reuptake inhibitor antidepressant: a case report and review of the literature" ppsx
... that serotonergic pathways play an important role in modulating inflammatory pain, compared with mechanistic pain Antidepressants have anti-inflammatory and analgesic properties Antidepressants ... important in mediating both inflammation and mood Inflammation modulates serotonergic system Inflammation upregulates serotonin transporter A key site of action of antidepressants is the serotonin transporter ... continued to maintain his remission More interesting is that the patient continues to be under remission despite not taking any disease-modifying agent or anti-inflammatory medications The patient was...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx
... GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG CTTGTACCTTTACTTCACTG-3', Antisense: 5'-GTC ACAGTTTTCA GCTGTATAGGG-3' Amplified PCR products were ... using the following primers: sense 5'-CGGGATCCCGATGGCTCTAACAA TGCTGC-3', antisense 5'-CGGAATTCCGCTTCGTGTGAAAGTATGGAG-3' The sense primer included the BamH1 restriction site and the antisense ... Statistical analysis All data are presented as the mean ± SE Statistical differences between groups were determined using a Student's t test and the Bonferroni correction Statistical analysis was...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: " Exploring the black box of quality improvement collaboratives: modelling relations between conditions, applied changes and outcomes" ppsx
... purpose The external change agents translated project targets into measurable indicators, and teams had to deliver monitoring data to a central database In this study, these monitoring data were ... interpreting the data, and drafting the manuscript PS assisted with the analyses and interpretation of the data As research manager of the independent evaluation study of the hospital improvement programme, ... improvement?'[41,42] The one- or two-day training meetings took place at central locations in the county The agendas contained presentations about background information on the project, team instruction sessions...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: " Intricacies in the surgical management of appendiceal mucinous cystadenoma: a case report and review of the literature" ppt
... cystoma and large bowel adenocarcinoma [6,8] Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written ... drafted the manuscript RA helped in identification and interpretation of pathology along with drafting the manuscript MRK conceived the study, helped in the interpretation of the data, drafted ... http://www.jmedicalcasereports.com/content/4/1/129 Competing interests The authors declare that they have no competing interests Authors' contributions TS collected the data, helped in its interpretation and...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Ethnic differences in the adaptation rate of HIV gp120 from a vaccine trial" ppsx
... estimating the dN/dS ratios independently for each fragment Mean dN/dS ratios across races and treatments were compared using ANOVA, linear models (lm) and pairwise ttests Because treating all non-whites ... vaccine studies and trials [19] Competing interests The authors declare that they have no competing interests Authors' contributions MPL, DP, and KC developed the genetic and statistical strategies ... vaccinated and placebo (non-vaccinated) white individuals To test whether levels of selection were significantly different between vaccinated and placebo individuals in different races, we analyzed...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: " Trans-inhibition of HIV-1 by a long hairpin RNA expressed within the viral genome" pps
... response Results Several antiviral approaches using extended lhRNA and long dsRNA molecules have been reported in plant and insect cells that lack the innate antiviral IFN response Transient expression ... supernatant at two days post-transfection Error bars represent the standard deviation from quadruple transfections in two independent experiments Page of 14 (page number not for citation purposes) ... for an attenuated virus vaccine and anti-HIV therapeutic virus in one Materials and methods DNA constructs and proviral DNA analysis The full-length molecular HIV-1 clone LAI [41] (Accession number...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: "Electrical muscle stimulation preserves the muscle mass of critically ill patients: a randomized study" ppsx
... prevent CIPNM Competing interests The authors declare that they have no competing interests Authors' contributions All authors have contributed substantially to the submitted work and have read and ... and approved the final manuscript In particular VG participated in the design of the study, data acquisition, analysis and drafting of the manuscript KS, KV and LK participated in data acquisition, ... patients Functional evaluation and muscle strength would have been the most appropriate endpoints in our study However, functional and muscle strength evaluation requires patient cooperation,...
Ngày tải lên: 13/08/2014, 19:20
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot
... complaining that chemists can t understand one another because the physical chemists speak a different jargon from synthetic organic chemists and so on And he says that biologists are better off ... one who s really good at explaining things The lecture ought to start with an introduction to some important area of biology and end with a list of some of the major outstanding problems in that ... forgotten something very important He’s forgotten that in the age of genomics, when biology is becoming more quantitative and depending more and more on new techniques and tools that must come...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Effect of corticosteroids on the clinical course of community-acquired pneumonia: a randomized controlled trial" pot
... trial of CAP patients admitted to a general hospital ward and presenting severe respiratory failure and extensive radiological consolidations support the hypothesis that an adjuvant steroid therapy ... morbidity (†) (3 to 10) (2 to 6) 0.02 *median and interquartile range; ns:no statistical significance (p > 0.05) (†) non paparametric Mann-Whitney U test (‡) Fisher exact two-tailed test *median and ... study concept and design SF, JD, NF, AF and SP contributed to acquisition of data SF, JD, CG, JC, FG and FM contributed to analysis and interpretation of data JD, CG, JC, FG and FM contributed...
Ngày tải lên: 14/08/2014, 08:21
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
... based on the finding that glypicans can bind to Wnts and to Frizzleds [16,18,22,36], and that transfection of glypicans increases the Wnt-binding capacity of the transfected cells [22] In the case ... glycolipid-enriched and detergentresistant It has been proposed that these domains facilitate selective protein-protein interactions that establish transient cell-signaling platforms [13] Unlike other GPI-anchored ... limited despite the recent advances A better understanding of these functions will make a significant contribution to the study of signaling pathways that play a very important role in developmental...
Ngày tải lên: 14/08/2014, 08:21