nào ai mạc mặt nào ai gọi hồn

... (100 U/ml) and 10% heat-inactivated FBS All cells were obtained from ATCC and maintained in a humidified atmosphere of 5% CO2 and 95% air 10 mg of DCQ was dissolved in ml of DMSO and stored in ... treatment were analyzed using the CometScore™software Percentage of DNA in the tail region, and tail moment (% DNA in tail × by tail length (μm)) were used as parameters to assess DNA damage p-ATM immunocytochemistry ... induced by DCQ including % DNA in comet’s tail (representing damaged DNA migrated away from nucleus), and tail moment (% DNA in comet’s tail multiplied by the tail length) Under normoxia, DCQ induced...

Ngày tải lên: 09/08/2014, 09:20

... methods Cell culture HCT116 and SW620 colorectal cell lines were obtained from the Cancer Research UK laboratories, and were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% ... so we stained cells for SA-b-gal activity, and showed that CDO alone did not increase the extent of staining However, in cells that had been cocultured with CDO and a cytotoxic drug, staining ... 5-FU or VP16 (all from Sigma) could be added Aliquots were removed daily for assessment of cell number and viability by staining with Trypan blue, and cell cycle distribution by flow cytometry...

Ngày tải lên: 07/03/2014, 15:20

... also containing lysozyme (1 mgÆmL)1; Sigma), a CompleteTM EDTA-free protease inhibitor cocktail tablet, and DNase I (5 lM; both Ó FEBS 2003 Phosphorylation of the T-cell receptor f chain (Eur ... subsequent tyrosines in the whole cTCRf chain in vitro, relative to the single-tyrosine-containing peptides, may well be due to the presence of an SH2 domain in Lck which binds to phosphotyrosines ... may influence the ability of its catalytic domain to reach the remaining unphosphorylated tyrosines of TCRf However, our studies using peptides containing single tyrosines show that Lck is capable...

Ngày tải lên: 08/03/2014, 02:20

... is its CH1 domain [10] Antibodies are composed of a basic unit of two heavy and two light chains, each of which has repeating units of ‘constant’ or ‘variable’ immunoglobulin domains, with the ... antibody diversity NMR analysis showed that, unlike the CL domain, the CH1 domain of IgG does not fold properly in isolation The CH1 domain needs the context of CL for productive antibody folding ... heavy and light chains This is consistent with reports that the ER chaperone BiP targets the CH1 domain [11,12], and labelled peptide-binding studies are ongoing to reveal the details of the BiP–CH1...

Ngày tải lên: 29/03/2014, 22:21

... majority of cells contained sub-2N DNA (cell death) as determined by cell cycle analysis “Early” responders were defined as cell lines in which the majority of cells contained sub-2N DNA within ... For the sensitive cell line MOLT16, a population of polyploid cells emerged within 24 hrs and maintained their growth with increasing drug concentration However, over longer period of drug treatment ... phenotype Not surprisingly, three CML lines with hyperdiploidy (>2n) and hypertriploidy (>3n) still maintained a sensitive response profile The sensitivity observed in CML cell lines, even with the polyploid...

Ngày tải lên: 18/06/2014, 22:20

... offspring were analyzed at days of age In brief, tissues obtained by tail clipping were digested at 55°C for 18 h in a lysis buffer containing mg/ml proteinase K, 0.5% lauryl sulfate (SDS), 100 ... infiltration of inflammatory cells in focal brain ischemia of hypertensive rats [38] Astrocytes are main cytokine/ chemokine-producing cells in the brain [34,37], and astrocyte-produced MCP-1 directs ... 23:7922-7930 Kumai Y, Ooboshi H, Takada J, Kamouchi M, Kitazono T, Egashira K, Ibayashi S, Iida M: Anti-monocyte chemoattractant protein-1 gene therapy protects against focal brain ischemia in...

Ngày tải lên: 19/06/2014, 22:20

... majority of cells contained sub-2N DNA (cell death) as determined by cell cycle analysis “Early” responders were defined as cell lines in which the majority of cells contained sub-2N DNA within ... For the sensitive cell line MOLT16, a population of polyploid cells emerged within 24 hrs and maintained their growth with increasing drug concentration However, over longer period of drug treatment ... phenotype Not surprisingly, three CML lines with hyperdiploidy (>2n) and hypertriploidy (>3n) still maintained a sensitive response profile The sensitivity observed in CML cell lines, even with the polyploid...

Ngày tải lên: 20/06/2014, 04:20

... samples, the staining intensity of each specimen was scored as follows: (weak staining; less than 10% of cells were positive), (intermediate staining; 10-50% positive) and (strong staining; >50% ... samples, the staining intensity of each specimen was scored as follows: (weak staining; less than 10% of the cells were positive cells), (intermediate staining; 1050% positive) and (strong staining; ... bone Primary cultures of GCTs were obtained from surgical samples of lytic bone lesions As previously described [6], fresh tumor tissues were minced in DMEM containing 10% FBS supplemented with 100...

Ngày tải lên: 20/06/2014, 04:20

... samples, the staining intensity of each specimen was scored as follows: (weak staining; less than 10% of cells were positive), (intermediate staining; 10-50% positive) and (strong staining; >50% ... samples, the staining intensity of each specimen was scored as follows: (weak staining; less than 10% of the cells were positive cells), (intermediate staining; 1050% positive) and (strong staining; ... bone Primary cultures of GCTs were obtained from surgical samples of lytic bone lesions As previously described [6], fresh tumor tissues were minced in DMEM containing 10% FBS supplemented with 100...

Ngày tải lên: 20/06/2014, 07:20

... by ongoing attempts to repair DNA while the cell is actively progressing through the cell cycle, although this remains to be shown It is clear, however, that DNA repair proteins, such as gH2AX, ... use of plateau phase cultures For these studies, cells were allowed to grow to confluence and maintained in confluence without medium change for days after which they were treated with loratadine ... (final reverse pulse 30 seconds) The running buffer (0.5× TBE) was re-circulated and cooled to maintain a temperature of 12-15°C These electrophoresis conditions were chosen based on methods of...

Ngày tải lên: 09/08/2014, 10:20

... system for 30 Tissue staining was visualized with a DAB substrate chromogen solution Slides were counterstained with hematoxylin, dehydrated, and mounted To validate each staining, the EGFR positive ... colon cancer section provided with the EGFR kit was used as positive control in each staining run For COX-2 staining, the positive control used the sample itself (internal control) The negative ... slides were first observed for staining status under low power microscope, and then randomly selected fields under high power (200×) light microscope For assessment of staining positivity, the number...

Ngày tải lên: 10/08/2014, 10:21

... 23 50 There was no significant relationship between COX-2 and EGFR P > 0.05 P < 0.05 Author details Radiation Oncology, Tumor Center, West China Hospital, Sichuan University, PR China 2Department...

Ngày tải lên: 10/08/2014, 10:21

... histone deacetylase, So it was considered aid actuating factor of HDACs to restrain transcription Talukger et al[15] studied, the molecule mechanism of MTA1 restraining ER alpha expression in breast ... pair:sense:5’-AGCTTAAAAAG CAACC CTGTCAGTCTGCTATAATTCAAGAGATTATAGCAGACTGACAGGGTT GCGG-3’, antisense: 5’-GATCC CGCAACCCTGTCAGTCTGCTATAATCTCTTGA ATTATAGCAGACTGACAGGGTTGCTTTTTA-3’, the second pair:sense:5’-AGCTT ... and 100 μg/ml streptomycin The cells were plated in a fully humidified atmosphere containing 5% CO2/95% air at 37°C The cells in exponential phase of growth were experimentized after digestion...

Ngày tải lên: 10/08/2014, 10:21

... Heart failure Pneumonia of unknown origin; respiratory failure Septic shock; ALI/respiratory failure Aspiration pneumonia; respiratory failure and shock Mycoplasma pneumoniae pneumonia – Heart failure ... remains unknown, and the rare association in the critically ill of HSV-1 isolation with mortality may represent reactivation of the virus in immunodepressed patients with multiple organ failure ... Prednisone Respiratory parameters PaO2/FiO2 (mmHg) 345 195 190 98 Plateau airway pressure (cmH2O) 33 22 22 20 Positive end-expiratory airway pressure (cmH2O) 12 7 Total respiratory compliance (ml/cmH2O)...

Ngày tải lên: 12/08/2014, 20:20

... passengers:/'pæsindʒə/ ride:/raid/ WHILE-LISTENING Look at the pictures and describe them WHILE-LISTENING Pre order these pictures WHILE-LISTENING Listen and order these pictures WHILE-LISTENING Listen again and decide ... POST-LISTENING V HOMEWORK - T asks ss to remember the story about Mr Lam and write about him and his daily routine ...

Ngày tải lên: 21/06/2013, 01:26

... 1: A day in the life of Period 4: Writing Vocabulary land (v): h¹ c¸nh take off (v): cÊt c¸nh air-hostess (n): n÷ tiÕp viªn hµng kh«ng seat belt (n): d©y an toµn fasten (v): th¾t announce (v):...

Ngày tải lên: 18/09/2013, 05:10

... watch TV 11 go to the bed * lead in: - It is Linh’sdaily routine -Do you have a daily routine? -is it same or different from Linh? 5ms 2.Pre-task: BRAIN STORM -ask ss think about some their activities ... ACTIVITIES * Instruction: -Divide class in to two teams: team A & team B -Show a video about linh’ daily routine in minute -ask ss to remember activities and time’s activities of Linh -2 ms for teams...

Ngày tải lên: 02/12/2013, 19:11

... MaintenanceCost1 MaintenanceDesc1 MaintenanceDate1 MaintenanceMiles1 MaintenanceCost2 MaintenanceDesc2 MaintenanceDate2 MaintenanceMiles2 MaintenanceCost3 MaintenanceDesc3 MaintenanceDate3 MaintenanceMiles3 ... Identifying Keys in the Logical Model 23 Contract Contracts With ∞ Employee Timesheet Name Address SSN E-Mail Type Salary BillableRate ∞ Completes Invoice EmployeeFirstName EmployeeLastName ClientName ClientLocation...

Ngày tải lên: 21/12/2013, 06:16

... starter culture Throughout growth, the temperature was maintained at 29 °C, and agitation was constant at 900 r.p.m A pH of 5.0 was maintained using 14% (w ⁄ v) ammonium hydroxide The glycerol ... available: Fig S1 Fluorescence titration of the FMN domain with the hMS AD Fig S2 Comparison of the electrostatic potentials of the surface of the CPR FMN domain and of a model of the FMN domain ... Redox form MS activity (nmolÆmin)1) Control – no hMS Without flavoproteina FMN domain oxidizedb FMN domain 1e) FMN domain 2e) MSR oxidized MSR 1e) MSR 2e) MSR 4e) < 0.01 0.24 ± 0.66 ± 1.86 ± 2.65...

Ngày tải lên: 18/02/2014, 08:20