mycn c myc target genes is a robust marker of poor overall survival independent of genomic mycn status age at diagnosis and disease stage
Báo cáo y học: "Distinct transcriptional MYCN/c-MYC activities are associated with spontaneous regression or malignant progression in neuroblastomas" ppsx
Ngày tải lên :
14/08/2014, 21:20
... marker of poor overall survival independent of genomic MYCN status, age at diagnosis and disease stage Having shown that MYCN/ c- MYC target gene activation is also associated with distinct neuroblastoma ... set of MYCN/ c- MYC target genes, whereas elevated c- MYC activity in stage 4-NA tumors induces a larger set of MYCN/ c- MYC target genes High expression of MYCN/ c- MYC target genes is a robust marker ... AMP MYCN- NA MYCN 1/2/3 4s MYCN- NA AMP MYCN ● ● 1/2/3 4s MYCN- NA AMP MYCN Figure Inverse correlation of MYCN and c- MYC mRNA levels in neuroblastoma subtypes Inverse correlation of MYCN and c- MYC...
- 14
- 220
- 0
báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot
Ngày tải lên :
10/08/2014, 10:21
... efficiency of UHRF1 as a marker to differentially diagnose pancreatic adenocarcinoma, chronic pancreatitis and normal pancreas [38] UHRF1 over-expression was also found in bladder cancer and the ... R, Hantel A, Thomas J, Fuchs CS: Association of dietary patterns with cancer recurrence and survival in patients with stage III colon cancer JAMA 2007, 298:754-764 Marques-Vidal P, Ravasco P, ... methylation on the same histone on lysine (H3K4me) Page of 10 is related to gene activation All these modifications are catalysed by a broad variety of specific enzymes, some of which can catalyse...
- 10
- 414
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
Ngày tải lên :
25/10/2012, 10:35
... require any deviation from routine medical practice Data collection and definitions At the time of ICU admission, for each patient we evaluated their age, gender, principal diagnosis, and vital signs ... Page of 10 (page number not for citation purposes) Critical Care Vol 12 No Abidi et al Table Clinical characteristics of study patients, C- reactive protein value, eosinophil count and leucocyte ... tion of data AZ participated in the coordination of the study AAZ participated in the design of the study, and performed the statistical analysis RA conceived of the study, participated in the...
- 10
- 597
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
Ngày tải lên :
18/06/2014, 22:20
... The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website Br J Cancer 2004, 91:355-358 20 Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer [http://cgap.nci.nih.gov/Chromosomes] ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Conveniently, it is standard clinical practice to perform karyotyping on hematological cancer cells and chromosome number can serve as an attractive resistance marker for patient response enrichment for...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
Ngày tải lên :
20/06/2014, 04:20
... The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website Br J Cancer 2004, 91:355-358 20 Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer [http://cgap.nci.nih.gov/Chromosomes] ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Conveniently, it is standard clinical practice to perform karyotyping on hematological cancer cells and chromosome number can serve as an attractive resistance marker for patient response enrichment for...
- 10
- 665
- 0
C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription
Ngày tải lên :
01/10/2015, 17:28
... CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT ... pET-2 1a) TI0248 CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC ... GACCAACCGGTTTCCCTCCCCCTTCATCTC TCCCTTTTTTTGTCT AGACAAAATGGTGGGCCGATGAAGGGCC ATCAGCACCGGTTGGTC GACCAACCGGTGCTGATGGCCCTTCATCG GCCCACCATTTTGTCT AGACAAAATGGTGGGCCGATGAAGGGGG AGGGAAACCGGTTGGTC GACCAACCGGTTTCCCTCCCCCTTCATCG...
- 85
- 291
- 0
C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription
Ngày tải lên :
02/10/2015, 12:56
... CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT ... pET-2 1a) TI0248 CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC ... GACCAACCGGTTTCCCTCCCCCTTCATCTC TCCCTTTTTTTGTCT AGACAAAATGGTGGGCCGATGAAGGGCC ATCAGCACCGGTTGGTC GACCAACCGGTGCTGATGGCCCTTCATCG GCCCACCATTTTGTCT AGACAAAATGGTGGGCCGATGAAGGGGG AGGGAAACCGGTTGGTC GACCAACCGGTTTCCCTCCCCCTTCATCG...
- 85
- 157
- 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
Ngày tải lên :
25/10/2012, 10:31
... 0.67) and did not correlate with age (p = 0.33) Circulating Ang-2 concentrations correlate with SOFA and APACHE II scores Linear regression analysis detected a strong association of logAng-2 concentration ... investigation of the prognostic value of circulating Ang-2 as a biomarker in critically ill patients The results are that: critically ill patients are characterised by an excess of circulating Ang-2 ... Available online http://ccforum.com/content/12/6/R147 Table Demographic, clinical and laboratory characteristics of patients Characteristics Total Non-septic patients Severe sepsis Septic shock...
- 9
- 634
- 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
Ngày tải lên :
20/01/2014, 20:20
... provider of education information and advice, with books and online resources focusing on education search, test preparation, and financial aid Its Web site offers searchable databases and interactive ... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... small differences in performance GMAT Score Tracker Diagnostic Practice Practice Test Test Test Practice Practice Test Test Final Practice Test Verbal Math TOTAL Verbal Subscore Sentence Correction...
- 696
- 1K
- 1
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
Ngày tải lên :
19/02/2014, 05:20
... ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCAGCCCATCCTGCTGCGGCTG ... ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC...
- 14
- 517
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
Ngày tải lên :
22/02/2014, 04:20
... nitrite as a standard Western blotting of inducible NO synthase Fig Structures of a- tocopherol (a- T) and T derivatives a- tocopheryl hemisuccinate (TS), a- tocopheryl acetate (TA) and a- tocopheryl nicotinate ... of < 0.01 was considered to be statistically significant Treatment of VSMC with TS RESULTS VSMC were isolated from rat thoracic aorta using the proteases elastase and collagenase as described previously ... apoptosis in hepatopoietic and cancer cell lines is caused by the prevention of PKC activity due to activation of PP 2A, similar to a- T activation of PP 2A [13] The reason for the inconsistency between...
- 6
- 494
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
Ngày tải lên :
07/03/2014, 05:20
... homologous human cDNAs Primers encompassing a putative ORF were designed as follows: 89, 5¢-ATCGAT ATGTTCCCAAACTCAATTTTGGGTCG-3¢; 90, 5¢-TAG AGACCAGTTATCTTTTCAG-3¢ Oligo(dT)-primed cDNA from SW80 cell ... mechanism underlying XRbm9-dependent translational activation is unclear and awaits further investigations The subcellular localization of mammalian Rbm9 is unclear and is dependent on the isoform ... I This hastening of maturation was correlated with a precocious synthesis of Mos and AuroraA proteins, and with the activation of the mitogen-activated protein kinase (MAPK) (Fig 4C) To confirm...
- 14
- 502
- 0
Báo cáo khoa học: "Creative Language Retrieval: A Robust Hybrid of Information Retrieval and Linguistic Creativity" pot
Ngày tải lên :
07/03/2014, 22:20
... the statistical breadth and convenience of automatic expansion Fortunately, statistical corpus analysis is an obvious area of overlap for IR and FLP Distributional analyses of large corpora have ... values), an accuracy of 64.02% using just attributes like temperature and color (8,934 attributes), and an accuracy of 85.5% using both together (a combined 59,979 features) How concisely and accurately ... be accessed online at: www.educatedinsolence.com/jigsaw/ Empirical Evaluation Though ^ is the most overtly categorical of our wildcards, all three wildcards – ?, @ and ^ – are categorical in nature...
- 10
- 384
- 0
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
Ngày tải lên :
16/03/2014, 11:20
... (5¢-ATGGAGGCCGGAGATTTCAAAG-3¢, +1 to +22 bp; and 5¢-ACGGGCTTTAAGTATTTCATCAGGC-3¢, +1405 to +1428 bp) and actin primer pair (5¢-TTCGAGCAG GAGATGGCCACC-3¢ and 5¢-GAGATCCACATCTGYTG GAAGGT-3¢) PCR was ... TH-speci c Regulation of melanin synthesis in insect cuticle primer pair (5¢-CAGCTGCCCAGAAGAACCGCGAGA TG-3¢, +11 to +36; and 5¢-GAACTCCACGGTGAACC AGT-3¢, +1286 to +1305 bp), DDC-speci c primer pair ... scintillation cocktail, and the radioactivity was counted in a liquid scintillation counter (Aloka LSC5100, Tokyo, Japan) Cloning and sequence analysis of TH cDNA Total RNA was isolated from integuments of...
- 10
- 440
- 0
Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx
Ngày tải lên :
23/03/2014, 10:20
... TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC ... oligonucleotides 5¢-GCGGTGACCCGGGAGATCTGAATTC3¢ (oligo A) and 5¢-GAATTCAGATC-3¢ The resulting products were purified and amplified by PCR with oligo A and oligonucleotide 5¢-ACTGAGCTAACATAACCCGG3¢, ... and 5¢-GAGATAACTTCGTATAGCAT-3¢; and for pLHC20 ⁄ loxP ⁄ -10 ⁄ TLN-6, P-del and 5¢-GATAACTTCG TATAGCATAC-3¢ The PCR conditions were as follows: 95 C for min; 30 cycles with for denaturation at...
- 12
- 399
- 0
Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf
Ngày tải lên :
29/03/2014, 09:20
... different constructs were DPP-III F-786: 5¢-CCCCTCGAGCCGTC CAGACCTGTAAAAG-3¢ ()781 ⁄ +5; pAAS-2), DPP-III F-490: 5¢-CACCTCGAGCTTTGCAACTTCCAAG-3¢ ()485 ⁄ +5; pAAS-3), DPP-III F-129: 5¢-CGACTCGAGAAG CTCGTCTTGG-3¢ ... C for and fluorescence recording at 80 C for 30 s Similarly b-actin cDNA was also amplified using primers b-actin F (sense) (5¢-AGAAAATCTGGC ACCACACC-3¢) and b-actin R (antisense) (5¢-TAGCACAGCCTGGATAGCAA-3¢), ... regulators of DPP-III transcription A A Shukla et al Materials and methods Cell culture Human glioblastoma (U87MG), ovarian carcinoma (Caov-2), pancreatic carcinoma (Panc1) and mouse fibroblast...
- 15
- 325
- 0
Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx
Ngày tải lên :
29/03/2014, 23:20
... used: b-actin: forward, 5¢-TGACAGGATGCAGAAGGA GA; reverse, 5¢-GCTGGAAGGTGGACAGTGAG; CD68: forward, 5¢-TCTACCTGGACTACATGGCGGTGG; reverse, 5¢-ACATGGCCCGAAGTGTCCCTTGTC For immunoblot, tissues were ... surface activator), such as matriptase [9] Matriptase is also a potent activator of pro-HGF/SF [12,30] The second pathway is mediated by humoral activators that are generated in injured tissues ... Roles of hepatocyte growth factor (HGF) activator and HGF activator inhibitor in the pericellular activation of HGF/scatter factor Cancer Metastasis Rev 22, 223–236 Miyazawa K, Shimomura T, Kitamura...
- 10
- 366
- 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
Ngày tải lên :
30/03/2014, 04:20
... et al (2000) Activation of NF-kappaB ⁄ Rel occurs early during neoplastic transformation of mammary cells Carcinogenesis 21, 871–879 Rayet B & Gelinas C (1999) Aberrant rel ⁄ nfkb genes and activity ... hydroxylase activity decreases and the degradation pathway described above is interrupted [44] HIF- 1a therefore rapidly accumulates and translocates into the nucleus, where, after dimerization with ARNT, ... This becomes paramagnetic when it is deoxygenated, and it is then detectable by magnetic resonance imaging Changes in blood flow modify the blood concentration of paramagnetic deoxyhaemoglobin and...
- 12
- 390
- 0
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf
Ngày tải lên :
30/03/2014, 09:20
... adhesion and activation Three such molecules, LAPP (an approximately 13 kDa leech antiplatelet protein isolated from Haementeria of cinalis) and calin and saratin (approximately 65 kDa and 12 kDa proteins, ... different concentrations of fibrillar collagen in the absence or presence of saratin (10 lgÆmL)1) Changes in attenuance indicative of shape change and aggregation were recorded (B) The delay in onset of ... as GPVI is capable of triggering platelet activation and release of secondary mediators (ADP and TxA2), which leads to platelet adhesion independently of a2 b1 However, in the absence of the actions...
- 11
- 440
- 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
Ngày tải lên :
30/03/2014, 20:20
... activated via a common specialized mechanism in both PTPCs and CLI-LNCs and may thereby participate in the terminal differentiation processes of these lateral neurosecretory cells 3859 Enhancement ... black and white images An area adjacent to the area of interest (A) and an area from an image lacking a specimen (N) were scanned as the background signals When PTPCs were not visible, the focal ... protocerebral lateral neurosecretory cells, which are likely type Ia1 neurosecretory cells The close anatomical localization between PTPCs and CLILNCs suggests that there are routes of communication...
- 10
- 437
- 0