my day a 3 4

... of parts A, B and C, Ss will be able to P 52-59 A My day - talk about everyday activities./ ask and answer about everyday activities B My routine - talk about their daily routine./ ask and answer ... - a door ( realia ) C a sổ - a window ( realia ) Học sinh - school bag ( realia) - a ruler ( realia ) - a pencil ( realia) - an eraser ( realia) - a pen ( realia) - T points to a desk and ask ... Wednesday Thursday Friday Nga & Ba Lan Practice reading the dialogue: IV Post - listening - SS ask and answer about Nga and Bas timetable - SS talk to each other about their timetable * Dialogue...

Ngày tải lên: 20/10/2014, 21:00

... between and : Ss are asked to read the new words after the teacher Then they practice reading chorally and individually Free practice : Ss are asked to look at the pictures and answer some questions ... listen to the tape and put the things in correct prepositions Look at the table There are many things on the table : a vase of flowers , a stereo, a doll , a dog and an apple The apple is in front ... Where are the tall trees ?- They are behind the house Practice the text : Trang Ss are asked to listen to the tape three times and repeat after the teacher without looking at their books Ss are...

Ngày tải lên: 13/10/2013, 21:11

Ngày tải lên: 01/11/2013, 12:20

... Language I ) la, 2b, 3b, 4a, 5b, 6b, 7b, 8a 2) Ih, Za, 3f, 4c, 5b, 6d, 79, 8e TIMESAVER PHRASALVERBS AND IDIOMS MARY GLASGOW MAGAZINES AN IMPRINT OF SCHOLASTIC INC Page 42 Page 55 Animal Behaviour ... sheared (tree) In A, there are apples on the tree; in B there are no apples on the tree Pages 22 & 23 Picture Interviews Student A Ib, 2b, 3a 4a, 5a, 6a Student B Ib, 2a, 3b, 4a, Sa, 6a Pages 24 ... she3 as f i t as a 7 .30 pm Babysat for my friend Victoria Buckingham Easy as pie The child was as good as Watched an a wards ceremony on 7-K Why wasn't I invited? I felt as sick as a ...

Ngày tải lên: 01/11/2013, 16:20

... uninhabited areas such as garages and basements In addition, spray the area around the outside of the house Alternatively baits are available which can be laid down in the general area of infestation ... cables, water and gas pipes, packaging and woodwork can all be seriously damaged They climb well and can squeeze through very small gaps They contaminate food and can carry many diseases, particularly ... colder weather, hatching may take as long as three weeks The larvae eat furiously for about 40 days before turning into pupae The pupa stage lasts eight to ten days in warm weather, and three to...

Ngày tải lên: 15/12/2013, 11:15

... Thursday See you Friday See you Saturday See you Sunday Have a nice day Adiós (ah-dyohs) Hasta luego (ahs-tah lweh-goh) Hasta mañana (ahs-tah mah-nyahnah) Hasta el lunes (ahs-tah ehl loo-nehs) Hasta ... Spanish Around the House la novia (lah noh-byah) la ahijada (lah ah-ee-hah-dah) el padrino (ehl pah-dree-noh) la madrina (lah mah-dree-nah) el ahijado (ehl ah-ee-hah-doh) la nieta (lah nyeh-tah) ... sahl-bah-dohr) Espa a (ehs-pah-nyah) Guatemala (gwah-teh-mah-lah) Honduras (ohn-doo-rahs) México (meh-hee-koh) Nicaragua (nee-kah-rah-gwah) Panamá (pah-nah-mah) Paraguay (pah-rah-gwah-ee) Perú (peh-roo)...

Ngày tải lên: 04/05/2014, 12:54

... : Đứng a hai tay dang ngang, đứng a hai tay lên cao chếch chữ V N1: Từ TTCB a hai tay dang ngang N2: Về TTCB N3:Đứng a hai tay lên cao chếch chữ V N4: Về TTCB N5,6,7,8 nh N1,2 ,3, 4 d) Đứng ... N1,2 ,3, 4 b) Ôn phối hợp : Đứng a hai tay trớc, đứng a hai tay lên cao chếch chữ V N1: Từ TTCB a hai tay trớc N2: Về TTCB N3:Đứng a hai tay lên cao chếch chữ V N4: Về TTCB N5,6,7,8 nh N1,2 ,3, 4 ... Đứng chỗ, vỗ tay hát - KT cũ(ND Gv chọn) Phần a) Ôn phối hợp : Đứng a hai tay trớc, đứng a hai tay dang ngang N1: Từ TTCB a hai tay trớc N2: Về TTCB N3:Đứng a hai tay dang ngang N4: Về TTCB...

Ngày tải lên: 15/06/2013, 01:26

... The Authors Journal compilation ª 2008 FEBS L A Alcaraz et al Fig Relaxation rates of CACW4 0A The relaxation rates are shown for (A) R1, (B) R2 and (C) 15N-1H NOE for CACW4 0A at 11.7 T Sample ... 32 99 33 11 ª 2008 The Authors Journal compilation ª 2008 FEBS 33 09 Dynamics of monomeric CAC L A Alcaraz et al 39 Farrow NA, Zhang O, Forman- Kay JD & Kay LE (1997) Characterization of the backbone ... Similar findings have been found in proteins of similar size at the same magnetic field, such as eglin c [32 ,33 ], CI2 [ 34 ], and the GAL4 domain [35 ,36 ] Mean R2 (= ⁄ T2, the transversal relaxation rates)...

Ngày tải lên: 07/03/2014, 06:20

... Allowing one substitution Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG ... AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG GAAGACATT ENSG000000 0 34 00 Caspase-10 101 675 8 14 801 35 5 31 5 9 63 808 41 8 262 651 725 857 caspase-10 gene, four variant motifs were identified Among them, AAACAGATG ... putative HIPPI-binding motif and its mutants ND, not determined Fluorescence quenching Sequence EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG...

Ngày tải lên: 07/03/2014, 10:20

... S41 Without OG S12 S45 S48 S 54 S55 T26 V29 M1 Q9 M3 V16 W6 D10 R31V21 V32 M25 L20 R4 F52 R42 R 53 V35 W49 S3 R36 A5 A4 4 I39 C 13 A4 3 A2 3 I 33 A2 W 34 A5 6 With OG 6% 118 V21 122 V35 126 I 33 130 130 ... characteristics of a full random coil conformation (a strong negative minimum at 195– 198 nm, and a weak negative signal at 220 nm) [ 34 ] Instead, we observed a maximum at 195 nm and a minimum at ... functional RNA element in the hepatitis C virus Core gene Proc Natl Acad Sci USA 1 04, 2879–28 84 Vassilaki N, Friebe P, Meuleman P, Kallis S, Kaul A, Paranhos-Baccala G, Leroux-Roels G, Mavromara P...

Ngày tải lên: 15/03/2014, 09:20

... with a @ character, that means that escape characters are not interpreted Escape characters are characters in a string that has a special meaning, and they always start with \ followed by a character ... need a way to save or store the data For this programs has variables, which may have or store a value A variable is characterized by a name a type operators Variables must have a name, so you can ... programming and the C# language Info about directories and files 236 FileInfo 236 DirectroryInfo 236 Object serialization 238 Datatypes 238 Binary serialization 240 Binary deserialization 244 XML...

Ngày tải lên: 18/03/2014, 02:20

... CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG ... 0 .4 0.2 0.1 0 .4 0 .3 0 .4 0 .4 CMV C 0.8 -galactosidase pA-EUA2 + lacZ ATG in lac-Z ORF pA-EUA2 + lacZ p - UA2core+1/S–myc pA-EUA2 0.8 0 .4 0 .4 - 0.2 0 .4 0.2 0 .4 0 .4 0.1 0 .4 0 .3 anti-core core -gal ... protein) after viral infection Proc Natl Acad Sci USA 101, 4 036 40 40 46 Twu JS & Schloemer RH (1987) Transcriptional transactivating function of hepatitis B virus J Virol 61, 34 48 34 53 47 Spandau DF...

Ngày tải lên: 30/03/2014, 03:20

... Biochemistry 43 , 9989–9998 34 90 30 Matsuura K, Tamada Y, Deyashiki Y, Miyabe Y, Nakanishi M, Ohya I & Hara A (1996) Activation of human liver alpha-hydroxysteroid dehydrogenase by sulphobromophthalein ... sulphobromophthalein Biochem J 31 3, 179– 1 84 31 Noriega GO, Juknat AA & Batlle AM (1992) Non-essential activation of rat liver porphobilinogendeaminase by folic acid Z Naturforsch [C] 47 , 41 6 41 9 32 Rockwell NC ... polypeptide was characterized by western blotting, amino acid analysis and N-terminal Edman sequencing (data not shown) MS analysis showed that the isolated CT-peptide had a molecular mass within Da of...

Ngày tải lên: 30/03/2014, 08:20

... GATCCGGCCGTCATGTGAAGCCACCAT GATCGCTAGCGTGTGATGAAGGCGGAGGCCTTGAATTCACG GATCCGGCCGATCCAGTCAGTCGTCTATAC GATCGCTAGCGTGTGATGAAGGCGGAGCAACAGCAGGAAGAC GATCGCTAGCGTGTGATGAAGGCGGAAGATGTAAAAGGTG GATCGAATTCTGGAAGATGTAAAAGGTG GATCGTCGACATCCAGTCAGTCGTCTATAC ... GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC GATCGAATTCGAGAGACTGGAAGGCAAAG GATCGGATCCTCATTTGCCTTCCAGTCTCTCAG GATCGGATCCTCAGCTGGAGAAATAAC GATCGGATCCTCAGTAATCCCGAGGCTCCTG GATCGGATCCTCATGGCATGCCCGGGAC ... GATCGAATTCACGCCCGCTTCGCCGAG, GATCGAATTCTGGCCGAGAGCCACCAGCAC, GATCGAATTCTGGCGGGGAACAAGCCG, GATCGAATTCTGCACAAGGTTCTGAACCA, GATCGAATTCTGAGCGACATGAAGGCGGAC, GATCGAATTCTAGCGGACGTGACCCGCCTG, GATCGAATTCCCATCGCAGCCCGCCTTCAGATG,...

Ngày tải lên: 30/03/2014, 09:20

... be as attenuated as rHPIV1-CR84GHNT553ALY 94 2A for AGMs This indicated that the LY 94 2A mutation independently attenuated HPIV1 for AGMs and can be used in the absence of the CR84GHNT55 3A mutation ... to achieve an optimal balance between safety and efficacy Conclusion The rHPIV1-CR84G/Δ170HNT553ALY 94 2A and rHPIV1-CR84G/ Δ170HNT553ALΔ1710–11 vaccine candidates are highly attenuated in AGMs ... 13 14 15 Acknowledgements We thank Ernest Williams and Fatemeh Davoodi for performing the HAI assays and Emerito Amaro-Carambot for assistance with sequencing We are grateful to Pamela Shaw and...

Ngày tải lên: 18/06/2014, 18:20

... be as attenuated as rHPIV1-CR84GHNT553ALY 94 2A for AGMs This indicated that the LY 94 2A mutation independently attenuated HPIV1 for AGMs and can be used in the absence of the CR84GHNT55 3A mutation ... to achieve an optimal balance between safety and efficacy Conclusion The rHPIV1-CR84G/Δ170HNT553ALY 94 2A and rHPIV1-CR84G/ Δ170HNT553ALΔ1710–11 vaccine candidates are highly attenuated in AGMs ... 13 14 15 Acknowledgements We thank Ernest Williams and Fatemeh Davoodi for performing the HAI assays and Emerito Amaro-Carambot for assistance with sequencing We are grateful to Pamela Shaw and...

Ngày tải lên: 20/06/2014, 01:20

... busy at certain times of the year At these times, people wash and decorate their cows Americans like to wash their cars, and Indians like to wash their cows! Two times a year, there are special ... Why Are Cows Special in India? About one billion people live in India Many people live on small farms They live a quiet and simple life The family takes care of the farm and the animals The ... but a cow can work Cows also not cost a lot of money They don't need gasoline or repairs like machines Farmers care about their cows very much They want their cows to be happy The farms aren't...

Ngày tải lên: 17/07/2014, 18:49

Ngày tải lên: 28/07/2014, 08:20

... but Don’t Extend 132 132 133 1 34 1 34 1 34 135 136 137 138 139 141 141 146 147 148 148 150 ix x CONTENTS Family Values ... take a look at Appendix A or check out Learn C on the Mac by Dave Mark (Apress 2009) CHAPTER 1: Hello Where the Future Was Made Yesterday Cocoa and Objective-C are at the heart of Apple’s Mac OS ... the name and you see a familiar term: “String” You already know that a string is a sequence of characters, usually human-readable, so you can probably guess (correctly) that an NSString is a sequence...

Ngày tải lên: 12/08/2014, 20:22