Giao an anh 6 standard
... - a student - a classroom - a school - a class - a door - a window - a desk - a teacher - a board Come in A1 - a waste basket a light a school bag a pencil a pen a ruler an eraser a clock P 20 ... - a door ( realia ) C a sổ - a window ( realia ) Học sinh - school bag ( realia) - a ruler ( realia ) - a pencil ( realia) - an eraser ( realia) - a pen ( realia) - T points to a desk and ask ... Im 12 13 11 14 Production EX 3: Play a game Noughts & Crosses 8 +2 10 :5 7x2 9-3 x4 12 +4 x2 20 :5 18 :3 Consolidation - Ask Ss to say out again the main content of this lesson : how to ask & answer...
Ngày tải lên: 20/10/2014, 21:00
... between and : Ss are asked to read the new words after the teacher Then they practice reading chorally and individually Free practice : Ss are asked to look at the pictures and answer some questions ... : beõn traựi cu a - to the right of : beõn phaỷi cu a - between and : gia v Grammar points : There is a / an + noun ( singular ) There are + noun ( plural ) III.Techniques of teaching : ... Where are the tall trees ?- They are behind the house Practice the text : Trang Ss are asked to listen to the tape three times and repeat after the teacher without looking at their books Ss are...
Ngày tải lên: 13/10/2013, 21:11
Ngày tải lên: 01/11/2013, 12:20
Phrasal Verbs Pre-Inter Advance - Around the house
... and says, "How can I help you?" "I'd like to buy a 25 -7 -23 -20 please," the woman says "A 25 -7 -23 -20 ?"says the shopkeeper "We don't sell 25 -7 -23 -20 -23 , madam I can you a 12 -7-9 -23 -14 -1 1 -15 ... 1- 15 or a 13 -22 -10 -5-6-8 -23 - 12 but I can't sell you a 25 -7 -23 -20 , this is a 20 -11 -14 shop." "You're lying to me," the woman says "Of course you can sell me a 25 -7 -23 -20 You've ... 6f, 7a, 8i, 9m, 10 1, l l e , 12 h, 13 9, 14 t, 15 r, 16 q, 17 u, 18 x, 19 n, 2Op, 21 z, 22 0, 23 s, 24 y, 25 w, 26 v The Joke A woman goes into a pet shop The shopkeeper smiles and says, "How can I help you?"...
Ngày tải lên: 01/11/2013, 16:20
Tài liệu Pests around the house pptx
... uninhabited areas such as garages and basements In addition, spray the area around the outside of the house Alternatively baits are available which can be laid down in the general area of infestation ... cables, water and gas pipes, packaging and woodwork can all be seriously damaged They climb well and can squeeze through very small gaps They contaminate food and can carry many diseases, particularly ... shelves, floorboards, carpets and upholstery Vacuum carpets on a regular basis Lift carpets and underlay and clean floors and carpet thoroughly An insecticide is needed to deal with a bad carpet beetles...
Ngày tải lên: 15/12/2013, 11:15
spanish around the house
... Thursday See you Friday See you Saturday See you Sunday Have a nice day Adiós (ah-dyohs) Hasta luego (ahs-tah lweh-goh) Hasta mañana (ahs-tah mah-nyahnah) Hasta el lunes (ahs-tah ehl loo-nehs) Hasta ... Spanish Around the House la novia (lah noh-byah) la ahijada (lah ah-ee-hah-dah) el padrino (ehl pah-dree-noh) la madrina (lah mah-dree-nah) el ahijado (ehl ah-ee-hah-doh) la nieta (lah nyeh-tah) ... Clothes Para comprar ropa 11 5 Jewelry Las joyas 11 8 Contents 11 Family Health and Well-Being La salud y el bienestar de la familia xi 12 1 At the Doctor’s Office En el consultorio del médico 12 1 Parts...
Ngày tải lên: 04/05/2014, 12:54
Giáo án Môn Thể Dục lớp 1
... hợp : Đứng a hai tay dang ngang, đứng a hai tay lên cao chếch chữ V N1: Từ TTCB a hai tay dang ngang N2: Về TTCB N3:Đứng a hai tay lên cao chếch chữ V N4: Về TTCB N5,6,7,8 nh N1 ,2, 3,4 d) Đứng ... Phần a) Đứng kiễng gót hai tay chống hông 1- 2L b) Đứng a chân trớc, hai tay chống hông 1- 2L c) Đứng a chân sau, hai tay giơ cao thẳng hớng N1 : a chân trái sau, hai tay giơ cao thẳng hớng N2: ... Đứng chỗ, vỗ tay hát - KT cũ(ND Gv chọn) Phần a) Ôn phối hợp : Đứng a hai tay trớc, đứng a hai tay dang ngang N1: Từ TTCB a hai tay trớc N2: Về TTCB N3:Đứng a hai tay dang ngang N4: Về TTCB...
Ngày tải lên: 15/06/2013, 01:26
Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx
... presented a mean of 3 .18 s )1 (range 2. 91 3.47) There FEBS Journal 27 5 (20 08) 329 9–3 311 ª 20 08 The Authors Journal compilation ª 20 08 FEBS L A Alcaraz et al Fig Relaxation rates of CACW4 0A The relaxation ... first a- helix presented a mean of 12 .3 s )1 (range 9 .1 14 .0); the second a- helix presented a mean of 13 .2 s )1 (range 11 .9 14 .2) ; the third a- helix presented a mean of 11 .3 s )1 (range 8 .19 – 13 .5); and, ... Sci 13 , 21 0 1– 21 0 7 FEBS Journal 27 5 (20 08) 329 9–3 311 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 3309 Dynamics of monomeric CAC L A Alcaraz et al 39 Farrow NA, Zhang O, Forman- Kay JD & Kay...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... Allowing one substitution Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG ... AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG GAAGACATT ENSG00000003400 Caspase -10 10 1 675 814 8 01 355 315 963 808 418 26 2 6 51 725 857 caspase -10 gene, four variant motifs were identified Among them, AAACAGATG ... Journal compilation ª 20 07 FEBS P Majumder et al gene upstream sequences are AAACAGATG () 25 4 to ) 26 2) in the positive strand, and AAAGAAAAG () 6 51 to 643), AAAGAAAAG () 725 to ) 717 ) and GAAGACATT...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc
... Core +1/ S NusA T7 28 22 37 T (°C) kDa P S P S P S NusAHCV- 1a Core +1/ S 72 55 28 22 T (°C) NusAHCV-1b Core +1/ S 28 17 11 28 P S P S P S 17 11 C kDa NusAHCV- 1a Core +1/ S NusA TEV kDa 72 55 NusAHCV-1b ... V35 W49 S3 R36 A5 A4 4 I39 C13 A4 3 A2 3 I33 A2 W34 A5 6 With OG 6% 11 8 V 21 122 V35 12 6 I33 13 0 13 0 10 .0 8.4 A1 7 8 .2 7.8 1H (p.p.m.) 8.4 8 .2 8.0 7.8 C C0 1 2 C α 1 2 C β 1 2 11 1. 0 0.5 SSP score ... (a. u.) A 67 43 29 A Boumlic et al B kDa (a) 13 .7 6.5 NusA 55 28 12 11 (b) 55 28 HCV- 1a Core +1/ S 11 (c) 55 28 20 40 60 80 a 10 0 HCV-1b Core +1/ S 11 b c Elution volume (mL) C kDa Ponceau Red 28 Anti-Core+1...
Ngày tải lên: 15/03/2014, 09:20
C#1 introduction to programming and the c language potx
... dictionary 21 3 Comparable keys 21 4 Cue list 21 5 Part IO 2 21 28 Text files 22 2 Write and read text 22 2 Write a comma separated ile 22 5 Read a comma separated ile 22 9 Binary files 2 31 Print 10 0 numbers ... programming and the C# language 11 Contents Inheritance 10 0 Points 10 0 Persons 10 2 12 he class Object 10 9 13 Abstract classes 11 3 Abstract points 11 3 Loan 11 5 Interfaces 12 2 Points again 12 2 Money ... with a @ character, that means that escape characters are not interpreted Escape characters are characters in a string that has a special meaning, and they always start with \ followed by a character...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot
... CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG ... core +1 fragment amino acids 72 11 5 and the transmembrane domain of the ATP-binding cassette transporter subfamily A (ABC1) amino acids 27 –69 The ABCA1 (ABC1) gene product translocates intracellular ... core nts 3 42- 514 nt 920 core pA-EUA2core (pHPI -14 99) ATG in core ORF nt 590 nt 825 CMV B core +1 myc ( +1) pA-EUA2core p - UA2core +1/ S–myc p - UA2 0.4 0.4 - pA-EUA2core +1/ S–myc with optimal ATG85 context...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... 11 , 26 51 26 65 Taylor NA, Van De Ven WJ & Creemers JW (20 03) Curbing activation: proprotein convertases in homeostasis and pathology FASEB J 17 , 12 15 12 27 Fricker LD, McKinzie AA, Sun J, Curran ... Matsuura K, Tamada Y, Deyashiki Y, Miyabe Y, Nakanishi M, Ohya I & Hara A (19 96) Activation of human liver alpha-hydroxysteroid dehydrogenase by sulphobromophthalein Biochem J 313 , 17 9– 18 4 31 ... isocratically at 10 % organic phase (acetonitrile containing 0 .1% trifluoroacetic acid) followed by a 1% Æmin )1 linear gradient of organic phase to 65% with a flow rate of mLÆmin )1 Elution was monitored...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot
... GATCGCTAGCGTGTGATGAAGGCGGAGCAACAGCAGGAAGAC GATCGCTAGCGTGTGATGAAGGCGGAAGATGTAAAAGGTG GATCGAATTCTGGAAGATGTAAAAGGTG GATCGTCGACATCCAGTCAGTCGTCTATAC GATCCTCGAGATCCAGTCAGTCGTCTATAC GATCGAATTCACAGAAGACATGA, GATCGAATTCTGGAGCAGGCGCTG ... GATCGGATCCTTAGAGGGCATCTGGGTCACAG GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC GATCGAATTCGAGAGACTGGAAGGCAAAG GATCGGATCCTCATTTGCCTTCCAGTCTCTCAG ... 18 8 9A: 18 7 7A: 18 7 0A: 18 6 2A: 18 5 1A: 18 4 3A: 18 3 2A: GATCGAATTCTCCTCTGAGCTGTCGTCTTGTA GATCGAATTCCCTGAGAGACTGGAAGGCAAAG GATCGGATCCACTTTGCCTTCCAGTCTCTCAG GATCGAATTCTTTGTCTGTGACCCAGATGC GATCGGATCCTTAGAGGGCATCTGGGTCACAG...
Ngày tải lên: 30/03/2014, 09:20
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... 6h HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT55 3A rHPIV1-C 17 0 rHPIV1-LY94 2A rHPIV1-CR84GHNT553ALY94 2A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/ 17 0HNT553ALY94 2A rHPIV1-CR84G/ 17 0HNT553AL 17 10 11 Mean sum ... 14 .8 ± 1. 2 11 .0 ± 2. 5 6.0 ± 1. 3 10 HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT55 3A rHPIV1-C 17 0 rHPIV1-LY94 2A rHPIV1-CR84GHNT553ALY94 2A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/ 17 0HNT553ALY94 2A rHPIV1-CR84G/ ... 6e HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT55 3A rHPIV1-C 17 0 rHPIV1-LY94 2A rHPIV1-CR84GHNT553ALY94 2A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/ 17 0HNT553ALY94 2A rHPIV1-CR84G/ 17 0HNT553AL 17 10 11 Virus...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx
... 6h HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT55 3A rHPIV1-C 17 0 rHPIV1-LY94 2A rHPIV1-CR84GHNT553ALY94 2A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/ 17 0HNT553ALY94 2A rHPIV1-CR84G/ 17 0HNT553AL 17 10 11 Mean sum ... 14 .8 ± 1. 2 11 .0 ± 2. 5 6.0 ± 1. 3 10 HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT55 3A rHPIV1-C 17 0 rHPIV1-LY94 2A rHPIV1-CR84GHNT553ALY94 2A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/ 17 0HNT553ALY94 2A rHPIV1-CR84G/ ... 6e HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT55 3A rHPIV1-C 17 0 rHPIV1-LY94 2A rHPIV1-CR84GHNT553ALY94 2A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/ 17 0HNT553ALY94 2A rHPIV1-CR84G/ 17 0HNT553AL 17 10 11 Virus...
Ngày tải lên: 20/06/2014, 01:20
what a world 1 - amazing stories from around the globe
... busy at certain times of the year At these times, people wash and decorate their cows Americans like to wash their cars, and Indians like to wash their cows! Two times a year, there are special ... Why Are Cows Special in India? About one billion people live in India Many people live on small farms They live a quiet and simple life The family takes care of the farm and the animals The ... but a cow can work Cows also not cost a lot of money They don't need gasoline or repairs like machines Farmers care about their cows very much They want their cows to be happy The farms aren't...
Ngày tải lên: 17/07/2014, 18:49
[Thể Dục Thể Thao] Nghệ Thuật - Kĩ Thuật Đá Cầu Phần 1 ppt
Ngày tải lên: 28/07/2014, 08:20
Learn Objective C on the Mac phần 1 pdf
... C HAPTE R 13 20 2 20 3 20 4 20 6 20 8 21 2 21 4 21 4 21 5 21 7 21 8 21 8 22 0 2 21 2 21 22 2 22 6 22 7 22 7 22 8 2 31 23 2 23 3 23 4 Protocols 23 5 Formal Protocols ... C HAP TER 10 8 10 8 11 3 11 3 11 4 11 5 11 5 11 6 11 8 12 1 12 1 12 2 12 3 12 3 12 3 12 4 12 4 12 8 12 9 13 0 A Quick Tour of the Foundation Kit 13 1 Some Useful Types ... C HAP TER 17 24 9 25 2 25 3 25 6 25 8 25 8 26 0 26 2 26 4 27 7 28 0 2 81 28 2 28 4 28 8 29 0 29 2 29 2 29 4 NSPredicate 29 5 Creating a Predicate ...
Ngày tải lên: 12/08/2014, 20:22