... the DataAdapter and CommandBuilder SqlDataAdapter da = new SqlDataAdapter(cmd); SqlCommandBuilder cb = new SqlCommandBuilder(da); // Fill table using the DataAdapter DataTable dt = new DataTable( ... changing data being read by a user and preventing users from reading data being changed by a user Locks are acquired and released by user actions; they are managed internally by database software ... locking as a transaction with an isolation level of REPEATABLE READ SERIALIZABLE Use the same locking as a transaction with an isolation level of SERIALIZABLE Table 6-22 SQL Server locking hints...
Ngày tải lên: 17/10/2013, 20:15
... the DataAdapter and CommandBuilder SqlDataAdapter da = new SqlDataAdapter(cmd); SqlCommandBuilder cb = new SqlCommandBuilder(da); // Fill table using the DataAdapter DataTable dt = new DataTable( ... changing data being read by a user and preventing users from reading data being changed by a user Locks are acquired and released by user actions; they are managed internally by database software ... locking as a transaction with an isolation level of REPEATABLE READ SERIALIZABLE Use the same locking as a transaction with an isolation level of SERIALIZABLE Table 6-22 SQL Server locking hints...
Ngày tải lên: 14/12/2013, 18:16
Tài liệu Determining the Length of Columns in a SQL Server Table doc
... // Add table mappings da.TableMappings.Add("Table", "Orders"); da.TableMappings.Add("Table1", "Order Details"); // Create the DataSet DataSet ds = new DataSet( ); // Fill the schema and data da.FillSchema(ds, ... Microsoft SQL Server Books Online The GetSchemaTable( ) method of the DataReader also returns all column lengths The method returns a DataTable containing column metadata for a DataReader, where ... da.FillSchema(ds, SchemaType.Mapped); da.Fill(ds); // Iterate over the table collection in the DataSet foreach(DataTable dt in ds.Tables) { schemaInfo.Append("TABLE: " + dt.TableName + Environment.NewLine);...
Ngày tải lên: 24/12/2013, 05:15
Weight loss maintenance in women two to eleven years after participating in a commercial program: a survey pptx
... participation in a popular commercial program in the province of Quebec, Canada This program, called Mincavi (meaning "thin for life" in French), has been enforcing Canada's Food Guide recommendations ... 6,6 Statistics Standard methods were used to calculate descriptive statistics and values are presented as means ± SD Analysis of variance (ANOVA) was used to analyze quantitative variables Using ... (67%) maintained a 5% loss from initial body weight Average loss maintained in that subset was a 16% decrease in body weight Age Some studies have shown a positive correlation between age and weight...
Ngày tải lên: 28/03/2014, 14:20
Báo cáo lâm nghiệp: " Effects of ectomycorrhizal inoculation and the type of substrate on mycorrhization, growth and nutrition of containerised Pinus pinea L. seedlings produced in a commercial nursery" docx
... (see Tab I for substrate analyses) The peat Floratorf was purchased at Floragard (Oldenburg, Germany) and the vermiculite Termita®, grade at Asflatex S .A (Barcelona, Spain) Trays with 39 alveoles ... mycorrhizas in forestry and agriculture, ACIAR Monograph 32, Camberra, Australia, 1996 [5] Castellano M .A. , Trappe J.M., Molina R., Inoculation of containergrown Douglas-fir seedlings with basidiospores ... inoculations and experimental set-up Pinus pinea L seedlings were produced in the commercial nursery owned by Forestal Catalana S.L in Breda (Girona, Northeastern Spain) A factorial experiment was set...
Ngày tải lên: 08/08/2014, 00:22
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx
... 642:CCTGATAGCGGCGGACCCCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACAGAGCACAACCCTCCTCCTCTGCCAGGGAGAACGACGAAGAAGAGGCGGC 643:CCTGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC ... ******************************************************************** p-env3f Contaminant 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAAAAAAAGGGCAAGAACATTTGAC 272 PmERV Chr 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAGAAAAAGGGCAAGAACATTTGAC 272 *********************************************.********************** ... 643:CAGGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGAGAGAACAATGAAGAAGAGGCGGC 642:CCTGATAGCGGCGGACCTCTCATTGATCTTCTCACAGAGGACCCCCCCGCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "The association between weight loss and engagement with a web-based food and exercise diary in a commercial weight loss programme: a retrospective analysis" pdf
... unbranded food items, automatically calculating an estimate of calorie intake A daily exercise diary encourages additional physical activity by setting a target to expend a minimum of an extra ... Covariates: initial BMI, and number of days between first and last recorded weight Separate analyses for each engagement variable Covariates as above and all engagement variables included in ... dependent variable was percentage weight loss, and initial BMI, and duration of programme use were included as covariates Age was not included as a covariate as it was not associated with percentage...
Ngày tải lên: 14/08/2014, 08:20
Tài liệu Integrating Microsoft Exchange Server 2007 in a Cisco Multisite Data Center docx
... geographical load balancing between sites In addition to being an ideal candidate for server and site load balancing, the CAS role can additionally take advantage of network optimization services and ... the ACE virtual context VIP hosting the ET roles using KAL-AP As defined earlier, KAL-AP provides load and VIP state information for each VIP maintained within a context hosting a KAL-AP agent ... Site Load-Balancing Internet Redundant External Firewalls Redundant Server Load-Balancers CAS CAS CAS CAS Redundant Internal Firewalls Standby CCR CMS Active CCR CMS Data Center 3 Data Center...
Ngày tải lên: 24/01/2014, 10:20
mcsa-mcse implementing & administering security in a microsoft windows server 2003 network self-paced training kit [exam 70-299]
... malicious attackers gain access to your network Password guessing, password cracking, and man -in- the-middle attacks all attempt to exploit weaknesses in an organization’s authentication strategy If an ... completing a task About This Book Note xxvii Contains supplemental information Caution Contains valuable information about possible loss of data; be sure to read this information carefully Contains ... constantly evolving, protecting your network against them requires implementing and administer ing an update management infrastructure More dangerous attacks are launched by malicious, skilled individuals...
Ngày tải lên: 25/03/2014, 11:50
nitrous oxide fluxes from a commercial beef cattle feedlot in kansas
... several days after a rainfall event The level of the soil microorganism activity has also been associated with seasonality and NO3 − availability.34 The increased N2O emission rate after rainfall ... lowest rainfall amount of 20 mm in winter 2010–2011 The prevailing wind direction in the area was south/southwest The feedlot had a total pen surface area of approximately 59 with a capacity of ... sampling periods (Fig. 4) As such, in succeeding sampling campaigns (ie, February through September 2011), during sampling, each available surface condition was covered by a SFC in each pen and...
Ngày tải lên: 28/05/2014, 14:38
Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc
... Científicas, Caracas) and a secondary antibody conjugated to alkaline phosphatase Foci were stained using a combination of 5-bromo-4-chloro3'-indolylphosphate p-toluidine salt and nitro-blue tetrazolium ... antigen in human serum Clin Vacc Immunol 2006, 13:1185-1189 Kumarasamy V, Chua SK, Hassan Z, Huahab AHA, Chem JK, Mohamad M, Chua KB: Evaluating the sensitivity of a commercial dengue NS1-antigen capture ... We thank Ferdinando Liprandi and Lorena Gutierrez for their critical reading of the manuscript and Fernando Medina for technical assistance We also thank Juan José Campos A from Bio-Rad S .A México,...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: " FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic contex" ppsx
... publicly available web servers Additionally CAPweb and arrayCGHbase can be obtained for local installation by requesting it from the maintainers FISH Oracle is available as a web server and additionally ... relational database to store its source data In particular, two different kinds of data are stored in two separate databases: genome annotation data (as available in the Ensembl database [37]) and ... the analysis of array-based DNA copy number data Biostatistics 2004, 5(4):557-572 42 Sakakura C, Mori T, Sakabe T, Ariyama Y, Shinomiya T, Date K, Hagiwara A, Yamaguchi T, Takahashi T, Nakamura...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo khoa học: "Evaluation of a commercial Erns-capture ELISA for detection of BVDV in routine diagnostic cattle serum samples" pdf
... determined in all sera using a commercial indirect ELISA (BVDV-Ab SVANOVIR™, SVANOVA Biotech AB, Uppsala, Sweden) 1.3 Heat inactivated sera To study the influence of heat inactivation, we selected a subset ... performance of the Erns ELISA was not influenced by heat inactivation, which can be an advantage in laboratories where sera are often subject to several analyses and therefore heat-inactivated ... negative) before and after heat inactivation at 56°C for 90 minutes (CCC = 0.99) Page of (page number not for citation purposes) Acta Veterinaria Scandinavica 2007, 49:7 http://www.actavetscand.com/content/49/1/7...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo sinh học: "Detecting parent of origin and dominant QTL in a two-generation commercial poultry pedigree using variance component methodology" docx
... conformation, a dominant and potentially over-dominant QTL explaining all of the QTL variance maps to around 80–118 cM on the consensus map Yonash et al., [23] find partial and overdominance for QTL affecting ... mat (4) pat + mat (4) pat + mat (4) null (1) null (1) null (1) null (1) null (1) add (2) add (2) pat (5) mat (6) additive additive + dominant paternal + maternal paternal maternal dominant parent ... map, is within a marker interval associated with many fat and carcass traits in chickens [22,24,30,43,44] Furthermore, McElroy et al., [28] and Tuiskula-Haavisto et al., [26] both find maternally...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " Genetic parameters of meat technological quality traits in a grand-parental commercial line of turkey" pot
... genetic analysis This line was in generation eight, after closing from a cross of two similar phenotypically female lines It was normally maintained with 60 males and 480 females The offspring used ... birds were slaughtered in a commercial plant (LDC, Sablé-sur-Sarthe, France) following usual commercial practices 626 É Le Bihan-Duval et al 2.2 Muscle sampling and meat trait measurements The ... chroma (C) and Hue (H) values were also calculated as C = (a 2 + b∗2 ) and H = tan−1 (b∗ /a ) Chroma is a measure of the colour intensity which increases when a and/or b∗ increases Hue indicates...
Ngày tải lên: 14/08/2014, 13:22
Design and Implement a SQL Server Database
... "database" chọn "New Database" hình vẽ sau: Sau việc đánh tên database click OK Ngoài dùng SQL script để tạo database Khi ta phải rõ vị trí primary data file transaction log file Ví dụ: USE master ... gọi data cache), sau data data cache thay đổi(những trang bị thay đổi gọi dirtypage) Tiếp theo thay đổi ghi vào transaction log file người ta gọi write-ahead log Cuối trình gọi Check Point Process ... ta nên chặt thành table sau: Books BookID Title Inside SQL Server 2000 Windows 2000 Server Beginning Visual Basic 6.0 Authors AuthID First Name Last Name A1 John Brown A2 Matthew Bortniker A3 ...
Ngày tải lên: 25/08/2012, 09:00
Multithreaded Programming in a Microsoft Win32* Environment
... doing something, the other threads can handle the user inputs and perform the tasks For example, if a user wants to cancel bringing in a large amount of data from a web page, a single threaded ... running at a higher priority can immediately react and cancel the operation When Not to Use Threads… Using multiple threads in an application does not guarantee any kind of a performance gain ... constantly interacting with the program, are independent activities The performance of an application can be improved by creating a separate thread for performing each of these activities rather...
Ngày tải lên: 12/09/2012, 14:40
Báo cáo y học: "Emergency intraosseous access in a helicopter emergency medical service: a retrospective study"
... and coordination, and in drafting the manuscript BEH participated in the design of the study and the statistical analysis, and participated in drafting the manuscript BHV participated in the design ... HEMS training programme, intraosseous training was given using manual needles, Bone Injection Guns, and EZ-IO® on both manikins and cadavers All HEMS physicians have used the technique on patients ... study, and the drafting of the manuscript and tables and figures All authors have read and approved the final manuscript Competing interests The authors declare that they have no competing interests...
Ngày tải lên: 25/10/2012, 10:02