mthfr 1298c as a possible teratogenic allele for spina bifida

CRH BP as a possible diagnostic marker for hepatocellular carcinoma

CRH BP as a possible diagnostic marker for hepatocellular carcinoma

... 5' ACGGTTTTAAGAGGGGAAAGTC 3' 5' ACGAACCCCAAAAAACTACG 3' CRH-BP-UF CRH-BP-UR 5' GATGGTTTTAAGAGGGGAAAGTT 3' 5' AACAAACCCCAAAAAACTACA 3' 128 CRH-BP-f CRH-BP-r 5’ CCAGCATGTCGCCCAACTT 3’ 5’ CCTATTCCCTCGCAACCTG ... stomach Lymphoma FANCF BRCA1 APAF1 Ovary Ovary Malignant melanoma HMLH1 Ovary MGMT Ovary, glioma, lymphoma Breast Breast Breast, thyroid, gastric Pancreas Pancreas ERβ Maspin E-cadherin Reelin DAB1 ... CCTATTCCCTCGCAACCTG 3’ 700 GAPDH-f GAPDH-r 5’ ACCACAGTCCATGCCATCA 3’ 5’ TCCACCACCCTGTTGCTGTA 3’ 453 HPRT1-f HPRT1-r 5’ ATGACCAGTCAACAGGGGAC 3’ 5’ CCAGCAAGCTTGCGACCTTGACCA 3’ 192 GW-CRH-BP-f 5’ AAA AAG CAG...

Ngày tải lên: 04/10/2015, 08:00

103 273 0
Báo cáo y học: "Daptomycin as a possible new treatment option for surgical management of Methicillin-Resistant Staphylococcus aureus sternal wound infection after cardiac surger" ppsx

Báo cáo y học: "Daptomycin as a possible new treatment option for surgical management of Methicillin-Resistant Staphylococcus aureus sternal wound infection after cardiac surger" ppsx

... colonization and infection with MRSA Standard therapy concerning antibiotic treatment has failed to eradicate the MRSA, so that we decided for an alternative antimicrobial strategy in the form of Daptomycin ... Germany) Daptomycin (4 mg/kg/day) was administered and total duration of application was ten days The wound eventually healed with no residual fistula or infection of MRSA (Figure 2) and she was ... need for alternative therapies that target MRSA has become apparent One alternative is Linezolid, because it has been shown that this antibiotic drug in retrospective evaluations of complicated...

Ngày tải lên: 10/08/2014, 09:22

3 342 1
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

... Oral Maxillofac Surg 2003, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... http://www.jmedicalcasereports.com/content/5/1/477 Page of Figure a) intraoral examination of her left lower jaw with fistula formation and pus on palpation in region 38; b) panoramic radiograph with mixed radiopaque and radiolucent areas surrounding ... TB, Assael LA, Landesberg R, Marx RE, Mehrotra B: American Association of Oral and Maxillofacial Surgeons position paper on bisphosphonate-related osteonecrosis of the jaws–2009 update J Oral Maxillofac...

Ngày tải lên: 10/08/2014, 23:20

4 234 0
Success as a real estate agent for DUMmIES

Success as a real estate agent for DUMmIES

... change as drastically as it can in the residential arena ߜ You construct your own database Commercial real estate is a database business For example, in office leasing you have to create a database ... 24 hours a day, days a week The National Association of Realtors ran a huge marketing campaign a few years ago They circulated brochures, ran newspaper and magazine ads, and aired national TV commercials ... sought-after speakers in the real estate arena He has spoken to agents and managers at the local, regional, national, and international level for most of the large real estate brands, such as Coldwell...

Ngày tải lên: 27/03/2014, 01:27

380 902 1
Diaspora Bonds as a New Funding Vehicle for Developing Countries pdf

Diaspora Bonds as a New Funding Vehicle for Developing Countries pdf

... e.g., Korean and Chinese diaspora in Japan; Indian and Pakistani diaspora in the United Kingdom; Turkish, Croatian and Serbian diasporas in Germany; Algerians and 11 National Jewish Population Survey ... facilitate—or constrain—the issuance of diaspora bonds include having a sizeable and wealthy diaspora abroad, and a strong and transparent legal system for contract enforcement at home Absence ... way of tapping into diaspora income flows on a regular basis,1 issuance of hard-currency-denominated bonds to the diaspora is a way of tapping into the latter’s wealth accumulated abroad Diaspora...

Ngày tải lên: 29/03/2014, 03:20

24 298 0
ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, “Design of plasmonic thin-film solar cells with broadband absorption ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Absorption enhancement in silicon compared with that without the aperture array in near-IR is near zero if no antenna array...

Ngày tải lên: 06/05/2014, 08:54

7 297 0
ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, “Design of plasmonic thin-film solar cells with broadband absorption ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Absorption enhancement in silicon compared with that without the aperture array in near-IR is near zero if no antenna array...

Ngày tải lên: 06/05/2014, 08:58

7 302 0
Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx

Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx

... the aorta (for the cases with more than one graft) After completion of the proximal anastomoses the extracorporeal circulation is interrupted and hemostasis is performed according to the standard ... Borger M, Rastan A, Mohr F: Beating heart coronary artery bypass in patients with acute myocardial infarction: a new strategy to protect the myocardium Myocardial Protection Futura Blackwell PublishingSalerno ... operation is carried out using an off pump coronary artery bypass (OPCAB) stabilizer in order to perform the necessary distal coronary anastomoses and subsequently the proximal by partial clamping...

Ngày tải lên: 10/08/2014, 10:20

4 370 0
báo cáo khoa học: "Epidural varicosis as a possible cause of radicular pain: a case report" docx

báo cáo khoa học: "Epidural varicosis as a possible cause of radicular pain: a case report" docx

... embolism was found to be caused by hypoplasia of her inferior vena cava, with a bilateral occlusion of her vena iliaca communis A diagnostic evaluation showed that a collateral pathway with ectatic ... vena cava lead to significantly better results [11] This is not always possible where there is hypoplasia and/or aplasia of the inferior vena cava, so, as in our patient’s case, only symptomatic ... diagnosis of radicular complaints A review of the recent literature and the case of our patient shows that the presence of epidural varicosis, without also being aware of a vascular abnormality,...

Ngày tải lên: 10/08/2014, 22:20

3 279 0
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot

báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot

... produce maps The participant explained: 'I thought that's what this was for, was to build capacity with a small little agency to be able to upload their own participation data and create a map all ... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... analyst/manager dyads were asked to participate and four declined The reasons given for declining included vacancies in the data analyst position, and already having access to a commercial GIS tool Data...

Ngày tải lên: 11/08/2014, 05:22

9 339 0
Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps

Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps

... percutaneous transluminal angioplasty Vasc Endovascular Surg 2009, 43(4):399-402 12 Khoury M: Failed angioplasty of a popliteal artery stenosis secondary to cystic adventitial disease: a case report Vasc ... Cassar K, Engeset J: Cystic adventitial disease: a trap for the unwary Eur J Vasc Endovasc Surg 2005, 29:93-96 Motaganahalli RL, Pennell RC, Mantese VA, Westfall SG: Cystic adventitial disease ... three cases treated by free vein graft Acta Chir Scand 1954, 108:217 Flanigan DP, Burnham SJ, Goodreaau JJ, Bergan JJ: Summary of cases of adventitial cystic disease of the popliteal artery Ann...

Ngày tải lên: 11/08/2014, 12:20

4 333 0
Báo cáo y học: " Coxiella burnetii as a possible cause of autoimmune liver disease: a case report" pps

Báo cáo y học: " Coxiella burnetii as a possible cause of autoimmune liver disease: a case report" pps

... alanine aminotransferase (ALAT, 120 U/L), gamma-glutamyl transferase (ү-GT, 240 U/L) and bilirubin (27 μmol/L) A test for malaria was negative Lumbar puncture, chest X-ray and abdominal ultrasound ... such as case clustering within well-demarcated geographical areas and an increased risk of recurrence after liver transplantation with increasing immunosuppression [10] Escherichia coli, atypical ... mycobacteria and retroviruses have been implicated as causative agents Roesler et al [11] identified a non-species-specific bacterial protein (b-subunit of bacterial RNA polymerase) as an antibody...

Ngày tải lên: 11/08/2014, 14:20

4 340 0
báo cáo khoa học: " HIV as a chronic disease considerations for service planning in resource-poor settings" docx

báo cáo khoa học: " HIV as a chronic disease considerations for service planning in resource-poor settings" docx

... S, Akabayashi A, Kai I, Ohi G, Naka K: Correlation between history of contact with people living with HIV/AIDS (PWAs) and tolerant attitudes toward HIV/AIDS and PWAs in rural Thailand International ... first-line antiretroviral therapy in South Africa Antivir Ther 2008, 13(7):937-43 Colebunders R, Kamya MR, Laurence J, Kambugu A, Byakwaga H, Mwebaze PS, Muganga AM, Katwere M, Katabira E: First-line antiretroviral ... Grover A, Citro B: India: access to affordable drugs and the right to health The Lancet 2011 Ihucha A: Worry for AIDS patients ahead of EU-India deal The Citizen Tanzania; 2010 Access to Essential...

Ngày tải lên: 11/08/2014, 14:21

6 291 0
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps

báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps

... produce maps The participant explained: 'I thought that's what this was for, was to build capacity with a small little agency to be able to upload their own participation data and create a map all ... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... analyst/manager dyads were asked to participate and four declined The reasons given for declining included vacancies in the data analyst position, and already having access to a commercial GIS tool Data...

Ngày tải lên: 11/08/2014, 16:20

9 318 0
Báo cáo y học: " Cracked mercury dental amalgam as a possible cause of fever of unknown origin: a case report" docx

Báo cáo y học: " Cracked mercury dental amalgam as a possible cause of fever of unknown origin: a case report" docx

... the biochemical and clinical data GG performed the endo-oral X-ray and managed the patient MEF had the original idea and wrote the paper All authors have read and approved the final manuscript Consent ... causes a sharp rise in intra-oral mercury vapor level We believe that a higher level of mercury vapor is released from cracked amalgam than from a previously intact amalgam filling, particularly ... the cracked amalgam surface lasted four weeks Mercury vapor is constantly emitted from amalgam surfaces and its release increases considerably during mastication, due to wear-abrasion Prolonged...

Ngày tải lên: 11/08/2014, 23:21

3 313 0
Báo cáo y học: " Cholestatic hepatitis as a possible new side-effect of oxycodone: a case report" pptx

Báo cáo y học: " Cholestatic hepatitis as a possible new side-effect of oxycodone: a case report" pptx

... cholangiopancreatography confirmed the presence of gallstones but was otherwise unremarkable with no ductal dilatation A liver biopsy was performed and was striking for the presence of canalicular ... increased plasma concentrations of some opioid peptides have been demonstrated in patients with cholestasis and in an animal model of cholestasis [4] Hepatocytes have been shown to increase mRNA for ... was asymptomatic His liver dysfunction was attributed to the earlier combination of anaesthetic agents with analgesics and thought to be transient Controlled release oxycodone was commenced and...

Ngày tải lên: 11/08/2014, 23:21

4 213 0
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

... type isolated from the spinal cord of a cow with astasia Archives of virology 2000, 145(11):2363-2370 Redaelli M, Cavaggioni A, Mucignat-Caretta C, Cavirani S, Caretta A, Donofrio G: Transduction ... below the pial surface Injection was carried out for 16 minutes and was performed using a Hamilton syringe Animals were monitored daily for neurological signs and weight loss At the appearance of ... English language correction and Italian Ministry of University and Scientific Research and the Fondazione Cariparma (Cassa di Risparmio di Parma, Italy) for funding contributions to the project Author...

Ngày tải lên: 12/08/2014, 02:20

6 232 0
Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx

Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx

... Hackett J Jr, Hoff-Velk J, Golden A, Brashear J, Robinson J, Rapp M, Klass M, Ostrow DH, Mandecki W: Recombinant mouse-human chimeric antibodies as calibrators in immunoassays that measure antibodies ... HT, Lu Q: An outbreak of enterically transmitted non -A, non-E viral hepatitis J Viral Hepat 1999, 6:59-64 Tanaka T, Takahashi M, Kusano E, Okamoto H: Development and evaluation of an efficient ... control of analytical results in the medical laboratory Eur J Clin Chem Clin Biochem 1996, 34:983-999 13 Koshy A, Grover S, Hyams KC, Shabrawy MA, Pacsa A, al-Nakib B, Zaidi SA, al-Anezi AA, al-Mufti...

Ngày tải lên: 12/08/2014, 04:20

5 311 0
Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc

Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc

... differentiation J Immunol 2004, 173:4523-4528 Mitsuyasu H, Yanagihara Y, Mao XQ, Gao PS, Arinobu Y, Ihara K, Takabayashi A, Hara T, Enomoto T, Sasaki S, Kawai M, Hamasaki N, Shirakawa T, Hopkin ... stimulator of osteoclastogenesis J Clin Invest 1999, 103:1345-1352 36 Yamada A, Takami M, Kawawa T, Yasuhara R, Zhao B, Mochizuki A, Miyamoto Y, Eto T, Yasuda H, Nakamichi Y, Kim N, Katagiri ... decrease RANK formation and by activation of receptors on osteoblasts that decrease RANKL expression but increase osteoprotegerin formation [36,38] In an animal model of osteoarthritis, intra-articular...

Ngày tải lên: 12/08/2014, 15:22

9 472 0
Báo cáo y học: "Protein C as a surrogate end-point for clinical trials of sepsis" docx

Báo cáo y học: "Protein C as a surrogate end-point for clinical trials of sepsis" docx

... endpoints for chronic diseases Stat Med 1992, 11:167-178 Vasan RS: Biomarkers of cardiovascular disease: molecular basis and practical considerations Circulation 2006, 113: 2335-2362 Vangerow B, ... Vincent JL, Bernard GR, Beale R, Doig C, Putensen C, Dhainaut JF, Artigas A, Fumagalli R, Macias W, Wright T, Wong K, Sundin DP, Turlo MA, Janes J: Drotrecogin alfa (activated) treatment in severe ... greater treatment benefit was observed The cohort was divided into groups with a higher and lower risk for death, based on the baseline biomarker cut-off levels The relative risk for death was...

Ngày tải lên: 13/08/2014, 10:20

2 222 0
w