mp4 a human hemoglobin modified with maleimide polyethylene glycol
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase (ACMSD) J Biol Chem 277, 35162–35167 Tanabe A, Egashira Y, Fukuoka SI, Shibata K & Sanada H (2002) Expression of rat hepatic 2-amino3-carboxymuconate-6-semialdehyde ... Cimadamore F, Orsomando G & Raffaelli N (2007) Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism...
- 9
- 796
- 0
Báo cáo khoa học: A superoxide dismutase–human hemoglobin fusion protein showing enhanced antioxidative properties pptx
... proteins, particularly when producing larger Hb conjugates As indicated earlier, catalase is a key component when generating functional Hb-based blood substitutes We have prepared an SOD–catalase fusion ... 906–912 Alagic A, Koprianiuk A & Kluger R (2005) Hemoglobin superoxide dismutase – chemical linkages that create a dual-function protein J Am Chem Soc 127, 8036–8043 Tarasov E, Blaszak MM, LaMarre ... in addition to cellular damage such as lipid peroxidation, protein oxidation, and DNA damage [21,22] Hb may generate reactive oxygen species, which can be particularly deleterious in clinical applications,...
- 9
- 389
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... Shikama, J (1997) Biphasic nature in the autoxidation reaction of human oxyhemoglobin Biochim Biophys Acta 1337, 96–104 22 Tsuruga, M., Matsuoka, A. , Hachimori, A. , Sugawara, Y & Shikama, K (1998) ... pH range from 5.3 to Tsuruga and Shikama [21] confirmed that the fast phase of oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain ... a water molecule which can then accelerate the displacement of the protonated superoxide anion, as was suggested by Tsuruga and Shikama [21] to explain the increase in oxidation rate of the a...
- 6
- 748
- 0
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx
... I-related receptor consisting of a heavy chain (HC) with three ectodomains (a1 , a2 and a3 ), a transmembrane part and a short intracellular signaling tail Like MHC class I HC, the FcRn counterpart ... Sundaresan G, Subbarayan M, Carter NH, Ikle DN, Yazaki PJ, Chatziioannou AF, Gambhir SS et al (2005) Tailoring the pharmacokinetics and positron emission tomography imaging properties of anti-carcinoembryonic ... The Authors Journal compilation ª 2008 FEBS 4103 A B A4 05 J T Andersen et al A4 05 FcRn HC mutant D A 405 C Fig Immunization, purification and evaluation of anti-FcRn antibody preparations Goat...
- 14
- 533
- 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... DAnorm ¼ aa Á expðÀka Á ½O2 Á tÞ þ ab ÁexpðÀkb Á ½O2 ÁtÞ ð2Þ where DAnorm is a normalized change in optical density of the sample and aa, ab, k a and k¢b are the amplitudes and rate constants ... R, Khan I, Juczszak L, Wang J, Manjula B, Acharya SA, Bonaventura C & Friedman JM (2004) Domain-specific effector interactions within the central cavity of human adult hemoglobin in solution and ... The authors thank Anna V Chistyakova and Dr Nona V Konovalova for preparing protein solutions This work was supported by the Belarusian Republican Foundation for Fundamental Research (Grant B00-176)...
- 11
- 577
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains...
- 11
- 427
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... graded transactivation potential Nucleic Acids Res 25, 2723–2729 13 Akagi K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation ... CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, transfection, and flow ... and with a GAPDH probe (cf Fig 2) Relative background transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed...
- 8
- 331
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... Tsuruga, M., Matsuoka, A. , Hachimori, A. , Sugawara, Y & Shikama, K (1998) The molecular mechanism of autoxidation for human oxyhemoglobin: tilting of the distal histidine causes nonequivalent oxidation ... the stability of human HbO2, we have used this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner ... EDTA at 35 °C In this tetramer, even if freshly prepared, the a- peak (at 577 nm) was always lower than the b-peak (at 541 nm) with an absorbance ratio of a/ b 0.90, this being in contrast to a...
- 10
- 648
- 0
harvard university press realism with a human face mar 1992
... chair could have Realism with a Human Face 27 been in a different place, as we say, what that means is that a counterpart of this chair could have been in that place; not that this very chair ... conclude that L) has a meta-language ML) L, has a meta-language ML z in just the way that anyone who accepts "All men are mortal" is immediately able to conclude (given the additional premise that Tom, ... Utopian; we can learn a great deal from partial and even fragmentary reconstructions, and we can learn a great deal from reconstructing our beliefs in alternative ways "Delicate mutual adjustment"...
- 210
- 224
- 0
annual report 2001 the bank with a human face ANZ
... Reduced balance sheet intensity > No Project Finance Loan Arranger, Asia Pacific, (Dealogic Capital Data Project Ware) > No Project Finance Loan Arranger, Asia, (Dealogic Capital Data Project Ware) ... Singapore, Taiwan, Thailand and Vietnam Pacific American Samoa, Cook Islands, East Timor, Fiji, Papua New Guinea, Samoa, Solomon Islands, Tonga and Vanuatu Ian Richards Head of Strategy Future Objectives ... endeavour and has already contributed $750,000 to the appeal ANZ and the Environment ANZ realises that it cannot separate its financial operations from the environmental impact and has appreciated...
- 35
- 339
- 0
Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc
... for A5 9V, A5 9V-R (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) and A5 9V-F (5’-CAA GCTGGAGGTGACGTTACTGAGAACTTTGAGG-3’); for A5 9 S, A5 9S-R (5’-CAAGCTGGAGGTGACTCTACTGAGAACTTTGAGG-3’) and A5 9S-F (5’-CA ... (5’CCAGCTTGTTCCCTGATAACTTCTTCCCCACC-3’) and L51I-F (5’-GGTGGGGAAGAAGTTATCAGGGAACAAGCTGG-3’); for L51T, L51T-R (5’-CCAGCTT GTTCCCTTGTAACTTCTTCCCCACC-3’) and L51T-F (5’-GGTGGGGAAGAAGTTACAAGGGAACAAGCT ... (5’-CA AGCTGGAGGTGACTCTACTGAGAACTTTGAGG3’); for G6 7A, G6 7A- R(5’-GGCATCTGTAGAGTGCGCGACATCCTCAAAGTTC-3’) and G6 7A- F (5’-GAAC TTTGAGGATGTCGCGCACTCTACAGATGCC-3’); and for G67 S, G67S-R (5’-GGCATCTGTAGAGTGCGAGACATCCTCAAAGTTC-3’)...
- 15
- 477
- 0
Báo cáo y học: "Phase delaying the human circadian clock with a single light pulse and moderate delay of the sleep/dark episode: no influence of iris color" potx
... African Americans had larger phase advances than Caucasians Because we found that African Americans had a shorter tau than Caucasians, which would augment phase advances relative to the Caucasians ... manuscript we also re-analyzed data from our previous phase-advancing study with daily light pulses [42] that included both light and dark-eyed Caucasians as well as dark-eyed African Americans, and thus ... had larger phase advances than Caucasians (n = 11) [40], suggesting that race, not iris color, was a factor mediating the magnitude of circadian phase shifts Although there are racial differences...
- 7
- 314
- 0
Báo cáo y học: "Moving towards high density clinical signature studies with a human proteome catalogue developing multiplexing mass spectrometry assay panels" doc
... internal standards These assay formats are usually applied, when any given concentration of a resulting outcome is assigned to a disease/health status SRM assays are also developed for relative quantitation ... health care area, both in monitoring and treating disease It is also the major disease area that requires assay-demanding activity, for clinical chemistry units at all major hospitals We have ... Extracted ion chromatograms of the Apolipoprotein assay in an LC-MS/MS analysis of pooled male (A) and female (B) plasma tryptic digest (RT: retention time, AA: peak area, using automatic integration)...
- 9
- 392
- 0
Báo cáo y học: "Are chest compressions safe for the patient reconstructed with sternal plates? Evaluating the safety of cardiopulmonary resuscitation using a human cadaveric model" docx
... Control lateral, xyphoid Cadaver 1 inferolateral Cadaver 2 lateral, xyphoid Cadaver lateral Cadaver lateral Cadaver lateral Figure Elevation and examination of deep sternal cortex and viscera McKay ... events is a complicated science Patient risk estimates are based on a number of known risk factors Cardiac and major vascular surgery places a patient at a higher risk for perioperative cardiac events ... cavity in which it was placed (Mentor Corp., Santa Barbara, CA) The manometer was connected via RS232 cable to a laptop and configured to display real-time intrathoracic pressure while simultaneously...
- 4
- 316
- 0
báo cáo khoa học: " 3-D reconstruction of a human fetus with combined holoprosencephaly and cyclopia" pptx
... 2) Both maxillae were hypoplastic, with three tooth anlagen on each side Between the maxillae the anlage of a single midaxial incisor was found (Fig 3a) No nasal septum or nasal cavity was present; ... nerve and the missing olfactory nerve, all other cranial nerves demonstrated a normal anatomical course (Fig 6) For comparison to normal anatomy, refer to Arnold and Kleiner [22] Cranial arteries ... was collected and alternately stained with either hematoxylin – eosin or azan Photomicrographs of every section were taken with a Nikon Coolpix 8400 camera with a resolution of megapixels In addition,...
- 11
- 292
- 0
Báo cáo y học: "The first report of human illness associated with the Panola Mountain Ehrlichia species: a case report" doc
... of a nymphal Amblyomma that was probably acquired at Panola Mountain State Park in Georgia in the United States of America The Panola Mountain Ehrlichia species was originally described from a ... insomnia due to pain The pain was refractory to anti-inflammatory medications, including acetaminophen, aspirin and ibuprofen Physical examination on 23 September was unremarkable Pyrexia was not ... detect antibodies against Anaplasma phagocytophilum, Borrelia burgdorferi, Coxiella burnetii, Francisella tularensis, Rickettsia africae, R akari, 'R amblyommii', R conorii, R parkeri, R prowazekii,...
- 3
- 285
- 0
Báo cáo khoa học: " Evidence for a novel gene associated with human influenza A viruses" pptx
... Talon J, Salvatore M, O'Neill RE, Nakaya Y, Zheng H, Muster T, Garcia-Sastre A, Palese P: Influenza A and B viruses expressing altered NS1 proteins: A vaccine approach Proc Natl Acad Sci USA ... www.cdc.gov/mmwr/preview/mmwrhtml/mm581 7a1 .htm] Steel J, Lowen AC, Pena L, Angel M, Solorzano A, Albrecht R, Perez DR, Garcia-Sastre A, Palese P: Live attenuated influenza viruses containing NS1 truncations as vaccine candidates against ... translation of an ORF from an influenza A virus genomic RNA, however, these data reinforce the fact that molecular processes are not perfect and that errors in transcriptional and translational...
- 12
- 253
- 0
Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx
... Figure Characterization of the dimerization state and splicing of viral RNA (A) Dimerization analysis of virion RNA Virion RNAs of different proviral constructs were separated on a native agarose ... compensatory mutations are uncommon in naturally occurring HIV-1 strains Furthermore, these data indicate that more than one mutational pathway can compensate for the loss of SL1 secondary RNA structure ... association with spliced HIV-1 mRNA compared to the wild type; 3- to 5-fold less HIV-1 mRNA was associated with the revertant Figure Characterization of the association between Gag and HIV-1 RNA (A) Measurement...
- 12
- 300
- 0
Báo cáo y học: " Human endogenous retrovirus HERV-K(HML-2) encodes a stable signal peptide with biological properties distinct from Rec" pps
... of small uncharged residues By analogy with motifs previously characterized in Rec, a putative arginine-rich nuclear localization signal (NLS; aa 13–20) and a leucinerich nuclear export signal ... and CAT-containing cell extracts were added into microplate wells coated with anti-CAT antibody, followed by addition of a digoxigeninlabeled anti-CAT antibody, and by addition of a peroxidase-conjugated ... identical N-terminal 87 aa, whereas the C-terminal and 18 aa for SP and Rec, respectively, are unrelated in sequence (Figure 2B) for reasons described above By analogy with previously characterized...
- 20
- 250
- 0
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "
... fixation with Figure Macroscopic images of the rats A: Appearance of the visceral pleura after abrasion with dry and iodinated spanch B: Placement of a x cm anti-adhesion membrane (Prevadh®) in the adhesion ... findings are also based on the result of macroscopic and histopathological examinations However, biochemical data would elucidate physiopathological changes associated with pleural adhesion and the ... Laboratory Animals Statistical analysis The results were recorded by the principal investigator and analyzed statistically upon completion of the study The statistical analysis was performed with...
- 7
- 453
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008