... from tape and validated Application: restored from tape and validated Data: restored from tape and validated Connectivity: restored and validated Redundancy of data: recover lost transaction ... transaction and validate Redundant site: ready (warm site) Recovery plans: ready OS: restored from tape and validated Application: restored from tape and validated Data: restored from tape and ... cost and risk to the business Contain costs Cannot add resources Continuity Defined: Ensuring applications and data are available during planned and unplanned outages 19 Go to View/Master/Slide...
Ngày tải lên: 24/04/2013, 20:04
... txtdich Private Sub thutucchapnhan_DragDrop(ByVal sender As Object, _ ByVal e As System.Windows.Forms.DragEventArgs) Handles _ txtdich.DragDrop txtdich.Text = e.Data.GetData(DataFormats.Text).ToString ... hinhbentrai.Image = _ Global.p _drag_ drop. My.Resources.hoamaudon Case hinhbentrai.Image = _ Global.p _drag_ drop. My.Resources.hoalongden Case hinhbentrai.Image = _ Global.p _drag_ drop. My.Resources.hoaloaken ... System.Object, _ ByVal e As System.EventArgs) Handles lbldanhsach.SelectedIndexChanged Select Case lbldanhsach.SelectedIndex Case hinhbentrai.Image = _ Global.p _drag_ drop. My.Resources.hoasungtim Case hinhbentrai.Image...
Ngày tải lên: 08/03/2014, 01:26
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
... ultracentrifuged and the sediments and supernatants obtained were analyzed (A) lane 1, Pharmacia low molecular mass standards; lane 2, ostreolysin (noncentrifuged); lane 3, ostreolysin (supernatant); lane ... collected citrated blood and washed twice with an excess of 0.9% saline and once with vesicle buffer Transformed cell lines, HT 1080 from human brosarcoma and MCF from human breast adenocarcinoma, were ... lgặmL)1), applied to a standard TLC silica plate, and run with chloroform/methanol/acetic acid/acetone/water (35 : 25 : : 14 : 2, v/v) The plates were then sprayed with the ninhydrin reagent and heated...
Ngày tải lên: 23/03/2014, 21:20
GIÁO TRÌNH MICOSOFT VISUAL BASIC - Chương 16 Lập trình Drag-and-Drop pdf
... làm thay đổi màu Listbox kéo mouse ngang qua Listbox Private Sub lstWords_OLEDragOver(Data As DataObject, Effect As Long, Button As Integer, Shift As Integer, X As Single, Y As Single, State As ... Visual Basic kích hoạt biến cố OLESetData đối tượng nguồn Lệnh viết cho biến cố OLESetData RichTextbox ví dụ sau: Private Sub rtfText_OLESetData(Data As RichTextLib.DataObject, _ DataFormat As ... OLEStartDrag viết sau minh h a đối tượng FileListBox làm đối tượng nguồn cho hoạt động kéo nhả: Private Sub File1_OLEStartDrag(Data As DataObject, AllowedEffects As Long) Dim i As Integer, path As...
Ngày tải lên: 27/07/2014, 03:20
Giáo án Tiếng Anh lớp 8: Unit 6 The young pioneers club Lesson 2 : Speak A/ Aims and Objectives : By the end of the lesson , pps
... dialogue and move around the class and help Ss - Call on some Ss to practice the dialogue in front of the class V / Homework : Learn by heart the expressions to offer assistance and favor and how ... need a favor * What can I for you ? * Can / could * How can I help you ? Repeat chorally , you ? * I am sorry I am really individually busy Offering Responding to assistance assistance * May I ... Thank you you ? * Yes That is very kind * Do you need of you any help ? * No thank you I am * Let me help fine Work in pairs Work in pairs you I can manage - Ask Ss to repeat chorally and...
Ngày tải lên: 08/08/2014, 02:22
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
... into an important disease model of rheumatoid arthritis European Journal Of Immunology 2000, 30:1568-1575 Kai H, Shibuya K, Wang Y, Kameta H, Kameyama T, TaharaHanaoka S, Miyamoto A, Honda S, Matsumoto ... sera A standard curve was created for each assay by including serial dilutions of a reference sample on each plate The reference sample was arbitrarily assigned an antibody concentration of AU/mL ... anti-collagen antibodies IgG1 (a) and IgG 2a/ c (b) anti-collagen isotypes were quantified in naïve mice and mice with early (up to weeks after onset) and late (6 to weeks after onset) arthritis after...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: " Axillary silicone lymphadenopathy presenting with a lump and altered sensation in the breast: a case report" pot
... rupture and/ or leakage increases with increasing age of the implant, the site of implantation (retroglandular as opposed to submuscular), the presence of local tissue contractures and/ or symptoms and ... tissue and autoimmune diseases and human adjuvant disease [4, 8, 9] At present, the mechanism of such complications is uncertain and in some cases, proof of such a relationship remains a source ... contributions STA was the primary author of the manuscript; JC provided critical appraisal and re-writing of initial drafts of the manuscript, and provided the radiological imaging and legends SR was the...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo khoa học: "The impact of empiric antimicrobial therapy with a β-lactam and fluoroquinolone on mortality for patients hospitalized with severe pneumonia" pptx
... Chow AW, Hyland RH: Summary of Canadian guidelines for the initial management of community-acquired pneumonia: an evidence-based update by the Canadian Infectious Disease Society and the Canadian ... the analysis of the data, and preparation of the paper All authors read and approved the final manuscript Acknowledgements EMM was supported by a Department of Veterans Affairs Veterans Integrated ... and levofloxacin in 7%, piperacillin-tazobactam and gatifloxacin in 5%, and ceftriaxone and gatifloxacin in 3.5% For subjects who received a β-lactam with fluoroquinolone, 30-day mortality was...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo y học: "Transpulmonary thermodilution using femoral indicator injection: a prospective trial in patients with a femoral and a jugular central venous catheter" ppt
... Transpulmonary thermodilution after femoral and jugular injection: Bland-Altman analysis Bland-Altman analysis of global end-diastolic volume index (a) , extra-vascular lung water index (b) and ... design and coordination and helped to draft the manuscript TS participated in the design of the study and performed the statistical analysis All authors read and approved the final manuscript Page ... surface area and extra-vascular lung water (EVLW) was indexed for predicted body weight Statistical analysis Bivariate correlation of quantitative data (means of paired measurements per patient)...
Ngày tải lên: 13/08/2014, 20:22
Báo cáo y học: "Signatures of human regulatory T cells: an encounter with old friends and new" pdf
... compared with the TReg cells (SATB1 and ACTN1 were upregulated in Th2 and down-regulated in TReg cells) SATB1 and TCF7 are transcription factors that are functionally similar to GATA3 and have ... activation and autoimmunity by Mgat5 Nglycosylation Nature 2001, 409:733-739 Nakahara S, Oka N, Raz A: On the role of galectin-3 in cancer apoptosis Apoptosis 2005, 10:267-275 Akahani S, Nangia-Makker ... Nolan KF, Graca L, Castejon R, Le MA, Frewin M, Humm S, Adams E, Thompson S, Zelenika D, et al.: Regulatory T cells and dendritic cells in transplantation tolerance: molecular markers and mechanisms...
Ngày tải lên: 14/08/2014, 16:21
BÀI LUẬN TIẾNG ANH HAY describe an encounter with a stranger
Ngày tải lên: 20/08/2015, 00:38
An Analysis of Small Business and Jobs by Brian Headd Office of Advocacy pot
... Haltiwanger, and Lane (2006) show what can be gleaned from this database by focusing on the impact of volatility on career paths and firms for five industries Small firms not necessarily create ... decline, and net job change in small and large firms The author would like to acknowledge the invaluable editing assistance of the Office of Advocacy’s Rebecca Krafft and input from the Bureau of Labor ... results, as the BED data are quarterly and based on establishments, while the SUSB data are annual and based on firms Figure Existing businesses are job creators Net Employment Change for Firm Dynamics,...
Ngày tải lên: 23/03/2014, 05:22
Digital design with CPLD applications and VHDL by dueck
... that allow us to transform any gate from an AND- shaped to an OR-shaped gate and vice versa DeMorgan equivalent forms Two gate symbols, one AND- shaped and one ORshaped, that are equivalent according ... they are out of phase Compare the enable/inhibit waveforms of the AND, OR, NAND, and NOR gates Gates of the same shape are enabled by the same Control level AND and NAND gates are enabled by a HIGH ... represent any gate in an AND form and an OR form To change a gate into its DeMorgan equivalent form, change its shape from AND to OR or vice versa and change the active levels of inputs and output...
Ngày tải lên: 01/04/2014, 17:47
02 write it in arabic a workbook and step-by-step guide to writing the arabic alphabet
Ngày tải lên: 03/04/2014, 12:40
Báo cáo y học: "Acute Complex Type A Dissection associated with peripheral malperfusion syndrome treated with a staged approach guided by lactate levels" ppt
... median sternotomy and cannulation via the previous right-axillary artery conduit, cardiopulmonary bypass was instituted and the patient was cooled to 22°C Antegrade cardioplegia and cerebral perfusion ... MM participated in this case and contributed to its analysis MH participated in this case and contributed to its analysis TA participated in this case and contributed to its analysis All authors ... vessels or coronary arteries and there was no pleural or pericardial effusion Arterial bloods gas analysis revealed a mild acidosis (pH 7.34 with a base excess of -5.7) and an elevated lactate level...
Ngày tải lên: 10/08/2014, 10:20
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ... to range between 0.75 and 2.00 kg/plant and 4.00 and 6.00 MT per hectare per year depending on agro-climatic zone and agriculture practices One hectare of plantation on average soil will give 1.6 ... Jatropha plant bears fruits from second year of its plantation and the economic yield stabilizes from fourth and fifth year onwards The plant has an average life with effective yield up to 50 years...
Ngày tải lên: 05/09/2013, 16:11
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... partially by a grant issued by the National Natural Science Foundation of China (grant no 30470159 ⁄ C01020304) and the National HighTechnology Research and Development Program (‘863’ Program) ... from amino acid sequence data Anal Biochem 182, 319–326 Liu Q, Kasuga M, Sakuma Y, Abe H, Setsuko M, Yamaguchi-Shinozaki K & Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: Fowlicidin-3 is an a-helical cationic host defense peptide with potent antibacterial and lipopolysaccharideneutralizing activities ppt
... MN, USA) and tested individually against fowlicidin-1 and fowlicidin-3 The MICs were determined by a standard broth microdilution assay as recommended by the Clinical and Laboratory Standards ... efficiency against both antibiotic-susceptible and antibiotic-resistant bacterial strains Killing of bacteria by fowlicidins starts immediately on contact with bacteria, in sharp contrast with human cathelicidin ... hydrophobicity, and helicity are among the most important factors that influence the antibacterial and toxicity of a- helical cationic peptides [23,24], rational changes of these structural and...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo sinh học: " An ectromelia virus profilin homolog interacts with cellular tropomyosin and viral A-type inclusion protein" doc
... cellular nuclei and little background staining with anti-HA and anti-Myc antibodies (negative control) (B) DAPI staining of cellular nuclei and viral DNA Discrete areas of DNA in the cytoplasm are ... infected with vTF7-3 and transfected with calf thymus DNA, show DAPI staining of cellular nuclei and little background staining with anti-HA and anti-Myc antibodies (negative control) (B) DAPI staining ... Rockland Immunochemicals Inc.) Actin was detected and visualized using rabbit IgG anti-actin primary antibody (Cat # A5 060, Sigma-Aldrich) and goat anti-rabbit IgG (H&L) IRDye 800 conjugate secondary...
Ngày tải lên: 18/06/2014, 18:20