move a time machine backup to a larger disk
Mac Kung Fu pot
Ngày tải lên :
06/03/2014, 20:20
... Space Find Out Where a File Was Downloaded From Make a Message Window Appear at Login Start Time Machine at the Command Line Repair Disk Problems Tear Off Tabs Move a Time Machine Backup to a Larger ... Trackpad When a Mouse Is Attached Install Only Printer Drivers and Not Their Add-ins Send Somebody a Link to an App Get a Bigger Search Area in Safari Copy Calculator Results Bookmark Images and ... designations appear in this book, and The Pragmatic Programmers, LLC was aware of a trademark claim, the designations have been printed in initial capital letters or in all capitals The Pragmatic...
- 318
- 5.6K
- 0
Once Its rationale, collective defense poses new challenge to a larger NATO
Ngày tải lên :
19/07/2013, 16:34
... Poland and NATO’s Baltic members that it take a tough stand Instead, NATO issued a tepid response, promising to establish a NATO-Georgia Council to strengthen ties — a far cry from Georgia’s goal ... sea, the leader of the separatist region of Abkhazia said he would invite Russia to establish a naval base at Sukhumi, a deep-water port in the territory But in a move certain to anger Russia, ... Cold War the West has used and abused international law to advance its geopolitical advantage (and usually against Russia’s legitimate security interests) The human rights factor is not part of...
- 35
- 308
- 0
The vocabulary builder : The Practically Painless Way to a Larger Vocabulary
Ngày tải lên :
31/08/2013, 14:24
... both a pheasant-like game bird and a complaint Add irant to the snake that bit Cleopatra for a word meaning a political candidate This red bird is also indispensable 10 To a male sheep, add ification ... United States of America Library of Congress Cataloging-in-Publication Data Kesselman-Turkel, Judi The vocabulary builder : the practically painless way to a larger vocabulary / Judi Kesselman-Turkel ... huge 14 Add gr to that Egyptian snake to achieve understanding 15 This polecat also means to search out 16 Add ess to the donkey to evaluate it 17 One of the lobes on a whale's tail is also a stroke...
- 163
- 659
- 2
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx
Ngày tải lên :
22/03/2014, 16:21
... stewed tomatoes and unsalted tomato sauce, garlic, basil, and oregano to a saucepan (use a potato masher to mash up stewed tomatoes in the pan) Let simmer Brown the chopped meat and strain any fat, ... min) Add vegetables back to heat Eat plain or over salad to make a great fajita salad Or serve in corn tortillas made with only corn, lime, and water Another variation:serve with tomatoes, guacamole, ... Salads and Salad Dressings 18 Mixed Green Salad with Strawberry Dressing 18 Black Bean Salad 18 Egg Salad 18 Bavarian Potato Salad 19 Greens with Vinaigrette 19 Orzo Salad 19 Pasta and Pea Salad...
- 123
- 392
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
Ngày tải lên :
18/06/2014, 16:20
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al ... 3’) SEA SED M18970 M28521 cttgtacatatgagcgagaaaagcgaagaa cgttctcgagaatgaaaacattgattc gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata ... gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat...
- 9
- 568
- 0
Báo cáo hóa học: " Using Simulated Partial Dynamic Run-Time Reconfiguration to Share Embedded FPGA Compute and Power Resources across a Swarm of Unpiloted Airborne Vehicles" pdf
Ngày tải lên :
22/06/2014, 22:20
... represent atomic operations These atomic operations then become states in a state machine Each time the machine transitions into a new state, the variables that make up the state of the application are ... minimize the amount of area fragmentation because fragmented area is not available for new applications How will the new network topology interact if we allow the allocator to favor locations that need ... This allows applications to not only migrate to increase performance or move closer to sources of data, but also allows power to be managed across a swarm to increase its overall mission time...
- 12
- 392
- 0
Báo cáo khoa học: "Scaling Phrase-Based Statistical Machine Translation to Larger Corpora and Longer Phrases" pptx
Ngày tải lên :
17/03/2014, 05:20
... parallel corpora to calculate phrase translation probabilities 4.1 Applied to parallel corpora In order to adapt suffix arrays to be useful for statistical machine translation we need a data structure ... is organized alphabetically, any phrase can be quickly located within it using a binary search algorithm Yamamoto and Church (2001) show how to use suffix arrays to calculate a number of statistics ... large data track translation including the joint probability phrasebased model (Marcu and Wong, 2002) and a variant on the alignment template approach (Och and Ney, 2004), and contrast them to...
- 8
- 316
- 0
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx
Ngày tải lên :
18/06/2014, 12:20
... Hiratzka LF, Hunt SA, Jacobs AK; American College of Cardiology; American Heart Association Task Force on Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management ... contrast to pharmacoinvasive therapy, the strategy of facilitated PCI relies on the idea that early initiation of pharmacotherapy (GP IIb/IIIA receptor blockers and/or thrombolytics) may lead to a more ... provided that the patient does not suffer from a true allergy to ASA This initial loading dose may also be given to patients who are already on ASA for reasons of primary or secondary prophylaxis Clopidogrel...
- 12
- 323
- 1
Tài liệu The Time Machine pptx
Ngày tải lên :
21/02/2014, 14:20
... of Time, any more than a savage or an animal has of staying six feet above the ground But a civilized man is better off than the savage in this respect He can go up against gravitation in a balloon, ... have told Blank, and Dash, and Chose about the machine? ’ he said to me, leaning back in his easy-chair and naming the three new guests 20 The Time Machine ‘But the thing’s a mere paradox,’ said ... Medical Man, who rang the bell—the Time Traveller hated to have servants waiting at dinner—for a hot plate At that the Editor turned to his knife and fork with a grunt, and the 18 The Time Machine...
- 120
- 548
- 0
Báo cáo khoa học: "Paraphrase Recognition Using Machine Learning to Combine Similarity Measures" ppt
Ngày tải lên :
08/03/2014, 01:20
... the translations of the same Chinese sentence as paraphrases We obtained all the possible paraphrase pairs and we added an equal number of randomly selected non paraphrase pairs, which contained ... showed that our MTC dataset is very easy BASE achieves approximately 95% in accuracy and F -measure, and an approximate performance of 99.5% in all measures (accuracy, precision, recall, F -measure) ... news articles about the same events Finally, Pang et al (2003) create finite state automata by merging parse trees of aligned sentences from a parallel corpus; in each automaton, different paths...
- 9
- 402
- 0
Báo cáo khoa học: "Using Machine-Learning to Assign Function Labels to Parser Output for Spanish" ppt
Ngày tải lên :
08/03/2014, 02:21
... Processing, Vancouver, B.C., Canada A L Berger, V J Della Pietra, and S A Della Pietra 1996 A maximum entropy approach to natural language processing Computational Linguistics, 22(1):39–71, March R ... vicinity of target node can have negative impact, greater reliance on context means greater susceptibility to parse errors Another factor to consider is the fact that we trained and adjusted parameters ... fstructure evaluation in comparison with the preceding Cast3LB tag assignment evaluation (Table 5) can be attributed to two main factors Firstly, the mapping from Cast3LB tags to LFG grammatical functions...
- 8
- 375
- 1
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
Ngày tải lên :
14/03/2014, 22:20
... When an bn , we say that an /bn is bounded from above by a constant which is asymptotically universal Similarly, bn , we say that an and bn are comparable up to a constant when an which is asymptotically ... asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ∪ P0 ), n n area(Pqn+1 ∪ Pqn+1 ), area(Qn ∪ Qn ) 0 ... rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic polynomials and quadratic rational maps...
- 53
- 383
- 0
The time machine
Ngày tải lên :
20/03/2014, 15:49
... miniature Time Machine and makes it disappear into thin air He then shows his disbelieving guests a full-scale Time Machine which he has made in his laboratory The next week, the guests return to ... Palace of Green Porcelain (a derelict museum) and finds more matches and a metal bar which he can use as a weapon That night, running away from the Morlocks through a dark wood, he accidentally ... agree? © Pearson Education Limited 2006 Chapters 7–9 Put students into pairs Ask them to have this conversation Student A: You are the Time Traveller You want Weena to leave her world and travel...
- 51
- 814
- 0
The Time Machine pot
Ngày tải lên :
22/03/2014, 23:20
... The laboratory grew faint and hazy, then fainter and ever fainter To- morrow night came black, then day again, night again, day again, faster and faster still An eddying murmur filled my ears, and ... of Time, any more than a savage or an animal has of staying six feet above the ground But a civilized man is better off than the savage in this respect He can go up against gravitation in a balloon, ... presently a fair-haired little creature seemed to grasp my intention and repeated a name They had to chatter and explain the business at great length to each other, and my first attempts to make the...
- 83
- 419
- 0
Báo cáo khoa học: "Using Machine Learning to Explore Human Multimodal Clarification Strategies" ppt
Ngày tải lên :
23/03/2014, 18:20
... information to a classifier, we compared the accuracy achieved in a 10-fold cross validation by a Na¨ve Bayes classifier (as a standard) on these ı data sets against the majority class baseline, ... driving) All features are automatically extracted from the XML log-files (and are available at runtime in ISUbased dialogue systems) From these features we want to learn whether to generate a screen ... interface to an MP3 player and were given access to a database of information 24 subjects were given a set of predefined tasks to perform using an MP3 player with a multimodal interface In one part...
- 8
- 373
- 0
Báo cáo khoa học: "Using Machine Learning to Maintain Rule-based Named-Entity Recognition and Classification Systems" pdf
Ngày tải lên :
23/03/2014, 19:20
... special symbols and punctuation marks At the separation substage, possible NEs that are likely to contain more than one NE or a NE attached to a nonNE, are detected and attachment problems are ... control has become obsolete and needs to be updated An important advantage of this approach is that no manual tagging of training data is needed, despite the use of a supervised learning algorithm ... application of classification rules, gazetteer-based classification, and partial matching of classified named-entities with unclassified ones Classification rules take into account both internal and...
- 8
- 400
- 0
It is time for us to check in for our flight ppt
Ngày tải lên :
25/03/2014, 03:20
... danh từ để bổ sung ý ngh a cho danh từ - “flight”- chuyến bay; danh từ theo sau tính từ sở hữu “our” “our flight”chuyến bay chúng ta/ chuyến bay - Lưu ý: cấu trúc “It’s time (for somebody) to ... lên máy bay ) “check” – động từ có ngh a kiểm tra, kiểm soát “in” – trong; giới từ Ở cấu trúc động từ để dạng nguyên thể có to (to Verb) cụ thể to check in” - “our”- chúng tôi, chúng ta; tính ... *It is time for us to check in for our flight Hình thức cấu trúc ngữ pháp: “It’s time (for somebody) to something” - đến lúc người làm việc Chúng ta quan sát câu sau Các bạn di chuột...
- 5
- 512
- 0
Báo cáo khoa học: "Applying Machine Learning to Chinese Temporal Relation Resolution" pptx
Ngày tải lên :
31/03/2014, 03:20
... A3 , , An ) p (c | A1 , A2 , A3 , , An ) (4) (5) Apply Bayesian rule to (5), we have: score(c | A1 , A2 , A3 , , An ) = p (c | A1 , A2 , A3 , , An ) p (c | A1 , A2 , A3 , , An ) n = p( A1 , A2 ... 600 cases are labeled manually and 100 left unlabeled Among those labeled, 400 are used as training data, 100 as test data and the rest as held-out data 4.1 Use of Linguistic Features As Classification ... then calculated as: S(eparate) A( uxiliary) and P(osition) words: we try to resolve the above ambiguity with the grammatical features of the indicators In this method, we assume that an indicator...
- 7
- 276
- 0
Breaking the Time Barrier How to Unlock Your True Earning Potential
Ngày tải lên :
26/05/2014, 22:02
... of the value you created for that health start-up That’s an impressive story that you can use to move away from charging based on time to charging based on value.” Steve nodded Karen was right—his ... relationship anew She did and here is what happened “Tara came back after a weekend of thinking and started asking me about my dog and why I wanted him to get walked That led to a whole conversation ... cost and rate calculators To run my shop and support the people I work with I personally need to generate almost $100,000 annually In your time- based world that works out to an average of $100 an...
- 70
- 433
- 1
time machine 1 secret of the knights
Ngày tải lên :
31/05/2014, 01:29
... Hispaniola 5) After the buccaneers began raiding ships, they used several islands as bases, including Port Royal, Jamaica Port Royal sank into the sea after an earthquake in 1692 6) A privateer ... special task that will take you to another time period As you face the dangers of history, the Time Machine often will give you options of where to go or what to This book also contains a Data Bank ... says to the captain, a stocky man named Broadstreet, and stalks off Broadstreet stares after him, amused “He’s not that bad a chap, really, but he’s got a lot to learn.” The captain puffs on...
- 130
- 447
- 0