molecular basis of human neoplasia a tutorial

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...

Ngày tải lên: 19/02/2014, 05:20

... infantile hypophosphatasia, (c) childhood hypophosphatasia, (d) adult hypophosphatasia and (e) odonto hypophosphatasia [1–4] Perinatal and infantile forms of hypophosphatasia are severe and are ... hypophosphatasia Eur J Med Genet 50, 367–378 Cai G, Michigami T, Yamamoto T, Yasui N, Stomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S et al (1998) Analysis of localization of mutated tissue-nonspecific ... Molecular basis of perinatal form of hypophosphatasia N Numa et al Hypophosphatasia is caused by various mutations of the tissue-nonspecific alkaline phosphatase (TNSALP) gene (EC...

Ngày tải lên: 07/03/2014, 05:20

... isolated DNA was extracted with phenol and chloroform, precipitated with ethanol and Na-acetate, and resuspended into water Total cellular DNA was also alternatively isolated with QIAamp DNA Blood ... Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown ... geminiviruses and plant circoviruses Arch Virol 143, 1723–1744 14 Okamoto H, Takahashi M, Nishizawa T, Tawara A, Sugai Y, Sai T, Tanaka T & Tsuda F (2000) Replicative forms of TT virus DNA in bone marrow...

Ngày tải lên: 16/03/2014, 05:20

... if it is a malignant renal carcinoma at an early or at an advanced stage, a benign tumor of mesenchymal origin, a melanoma metastasis, AN INTRODUCTION TO HUMAN CANCERS 21 or a lymphoma However, ... Designation Tumor Malignant tumor Benign tumor Cancer Neoplasia Leukemia Lymphoma Sarcoma Carcinoma Adenoma Adenocarcinoma Tumor stage Tumor grade Meaning Remarks any abnormal increase in also ... PART I MOLECULES, MECHANISMS, AND CELLS This page intentionally left blank MOLECULAR BIOLOGY OF HUMAN CANCERS This page intentionally left blank Molecular Biology of Human Cancers An Advanced...

Ngày tải lên: 08/04/2014, 12:51

... lyase pathway) Bottom: cleavage to yield AMPA and glyoxylate (the AMPA pathway), referred to as the GOX pathway (B) Reaction catalyzed by GO on glyphosate, an alternative to the AMPA pathway as ... glyphosate cannot be regarded a mere analog of PEP, but it rather appears to mimic an intermediate state of PEP, presumably that of the elusive carbocation More than 1000 analogs of glyphosate have ... mechanism different from that of GOX Oxidases GOX (Monsanto) Early on, Monsanto Co isolated glyphosate-AMPA bacteria from a glyphosate waste stream treatment facility Achromobacter sp LBAA was...

Ngày tải lên: 14/02/2014, 14:20

... Takeuchi and F Ito Molecular mechanisms of sensitivity to EGFR-TKIs Fig Major signaling pathways downstream of the activated EGFR Activation of several signaling cascades triggered predominately ... caspase-9 and caspase-3, which are cystein proteases that cleave vital cellular targets and cause apoptosis Caspases can be inhibited by members of the inhibitor of apoptosis protein (IAP) family ... intrinsic apoptotic pathway via trafficking of activated Bax to the mitochondria [62] Akt is known to phosphorylate Bax and to prohibit its mitochondrial translocation However, the Akt pathway plays a...

Ngày tải lên: 16/02/2014, 09:20

... Diffuse Lung Diseases and Respiratory Failure, National Hospital Organization Kinki-Chuo Chest Medical Center, Sakai, Osaka, Japan Sabina Janciauskiene, PhD, Department of Clinical Sciences, University ... India Teruo Tachibana, MD, Department of Internal Medicine, Aizenbashi Hospital, Osaka, Japan Bruce C Trapnell, MD, Department of Pediatrics and Department of Internal Medicine, University of ... to see a zebra Theodore E Woodward, MD, University of Maryland, Circa 1950 (1) Abstract The National Institutes of Health Of ce of Rare Diseases (ORD) defines a rare or orphan disease as a disorder...

Ngày tải lên: 05/03/2014, 23:20

... threshold (Fig 2) and by assuming that a CaM binding domain has to have a length of at least around 15 residues For quantitative estimates of the binding of CaM and CaM mutants to peptides and fusion ... CNG channels and of KCNQ channels On the one hand they are activated by membrane depolarization 1082 and not inactivate as KCNQ channels On the other hand EAG channels harbor a C-terminal putative ... voltage of half-maximal gate activation and km the corresponding slope factor G is the maximal conductance of all channels and Erev the reversal potential Functional expression of hEAG1 channels...

Ngày tải lên: 07/03/2014, 12:20

... only) Our function tagging task is easier than finding grammatical relations as we tag a headword of a chunk as e.g a subject in isolation whereas grammatical relation assignment also includes deciding ... learning shallow natural language patterns In Proc of 36th annual meeting of the ACL, pages 67–73, Montreal M Banko and E Brill 2001 Scaling to very very large corpora for natural language disambiguation ... with a fixed training set size might present a misleading snapshot Second, the amount of training material available today is already enough to make words more valuable input than (gold-standard!)...

Ngày tải lên: 08/03/2014, 07:20

... Rosalind Franklin RNA (A pairs with U and C pairs with G) Examples: mRNA tRNA rRNA snRNA messenger RNA transfer RNA ribosomal RNA small nuclear RNA RNA secondary structure: Yeast Alanine tRNA single-stranded ... amount of T and amount of G = amount of C (Chargraff’s rules) • %GC content varies from organism to organism Examples: %A %T %G %C %GC Homo sapiens Zea mays Drosophila Aythya americana 31.0 25.6 ... autoclaved without degrading! 5’ and 3’ The ends of the DNA or RNA chain are not the same One end of the chain has a 5’ carbon and the other end has a 3’ carbon 5’ end 3’ end James D Watson & Francis...

Ngày tải lên: 13/03/2014, 16:34

... Rosalind Franklin RNA (A pairs with U and C pairs with G) Examples: mRNA tRNA rRNA snRNA messenger RNA transfer RNA ribosomal RNA small nuclear RNA RNA secondary structure: Yeast Alanine tRNA single-stranded ... amount of T and amount of G = amount of C (Chargraff’s rules) • %GC content varies from organism to organism Examples: %A %T %G %C %GC Homo sapiens Zea mays Drosophila Aythya americana 31.0 25.6 ... autoclaved without degrading! 5’ and 3’ The ends of the DNA or RNA chain are not the same One end of the chain has a 5’ carbon and the other end has a 3’ carbon 5’ end 3’ end James D Watson & Francis...

Ngày tải lên: 13/03/2014, 17:04

... of the Aeromonas toxin proaerolysin in its water-soluble and membrane-channel states Nature 367, 292–295 62 Akiba T, Abe Y, Kitada S, Kusaka Y, Ito A, Ichimatsu T, Katayama H, Akao T, Higuchi ... Miyata S, Matsushita O, Minami J, Katayama S, Shimamoto S & Okabe A (2001) Cleavage of a C-terminal peptide is essential for heptamerization of Clostridium perfringens epsilon-toxin in the synaptosomal ... Matsushita O, Katayama S, Jin S, Matsushita C, Minami J & Okabe A (1996) Purification, characterization, and primary structure of Clostridium perfringens lambda-toxin, a thermolysin-like metalloprotease...

Ngày tải lên: 14/03/2014, 22:20

... shown that Aerovant can also ameliorate allergic asthma in human patients [55] Following the same rationale, an antagonist of growth hormone has been designed and developed [60] Increased growth ... phase IIB trials as a drug candidate for the treatment of allergic asthma [55]; a growth hormone mutein, Pegvisomant, is already in clinical use for the treatment of acromegaly [56] Allergies and ... asthma represent a nuisance in the case of seasonal rhinitis or conjunctivitis and a life-threatening condition in anaphylactic shock and asthma IL-4 and IL-13 are the hormones that make us allergic...

Ngày tải lên: 15/03/2014, 09:20

... spectrophotometer (Agilent, Santa Clara, CA, USA) The forward enzymatic assay contained a buffer mixture adjusted at pH 7.0 (50 mm potassium phosphate and 10 mm each of acetic acid, Mes and Tris), 5–10 ... Moreno-Sanchez R, Encalada R, Marı´ n-Hernandez A & Saavedra E (2008) Experimental validation of metabolic pathway modeling An illustration with glycolytic segments from Entamoeba histolytica FEBS ... structural analysis it became evident that the amino group at carbon of the guanine ring may interact with the side chain of Glu309, whereas the carbonyl group at position of the guanine ring may...

Ngày tải lên: 16/03/2014, 01:20

... to retrograde transport and proteasome degradation Proc Natl Acad Sci USA 98, 14955–14960 23 Yedidia Y, Horonchik L, Tzaban S, Yanai A & Taraboulos A (2001) Proteasomes and ubiquitin are involved ... N-terminal domain of PrPC or the HD only, was sorted basolaterally, indicating that this domain acts as a dominant sorting signal Vice versa, Dpl or PrPC lacking the HD were found mainly at the apical ... show that aggresome formation in scrapie-infected mouse neuroblastoma (ScN 2a) cells induces caspase-3 activation and apoptosis [28] Toxicity of PrP located at the plasma membrane Spontaneous...

Ngày tải lên: 30/03/2014, 09:20

... stopped after 14 days of treatment The body weight of animals housed in pairs was monitored on a daily basis at 09.00, i.e immediately after the dark cycle Results are shown as the average weight gain ... calculate body fat and lean mass This has been shown to detect a range of 5–30% body fat mass with a correlation of 0.98 to values obtained by chemical analysis [49] The machine was calibrated before ... weight gain and weight loss Whether these elements form part of the cause of metabolic dysfunction leading to the accumulation of fat mass remains to be determined Available epidemiological data addressing...

Ngày tải lên: 30/03/2014, 11:20

... Met in animal sequences and a Val in cyanobacteria, Phe120 becomes a Val or Leu in mammalian and other animal ⁄ bacterial sequences, respectively, Ile214 is a Leu in cyanobacterial and animal HOs, ... concentrations of ascorbate [50] and perhaps plant HOs have evolved to take full advantage of this In conclusion we have demonstrated that the pcd1 mutant of pea has a mutation in the HO1 gene and have ... Solara using degenerate primers PS1.FOR 5¢-GAG GAN ATG AGN TTN GTN GCN ATG AGA-3¢ and PS1.REV 5¢-CCA CCA GCA NTA TGN GNA AAG TAG AT-3¢ Amplification products were ligated into pCR2.1 (TOPO TA cloning...

Ngày tải lên: 30/03/2014, 11:20

... distances of H3N2 HA and NA proteins since 1999 and (B) amino acid distances of H3N2 HA and NA (A) Seasonal amino acid next (A) Seasonal amino acid distances of H3N2 HA and NA proteins since 1999 and ... was extracted from 140 µl of human nasal swab suspension or nasopharyngeal aspirate by QIAamp® Viral RNA Mini Kit (QIAGEN, Germany) as described by the manufacturer or by an automated MagNA Pure ... total of 234 Danish human nasal swab suspensions or nasopharyngeal aspirates positive for influenza A, from 1999 to 2006, were available at the WHO National Influenza Centre, Copenhagen The seasonal...

Ngày tải lên: 20/06/2014, 01:20

... H1N1 and H3N2 viruses are lower than the plasma concentration of chloroquine that can be attained with dosages used in the prophylaxis and treatment of acute malaria [12] This suggests that the ... Spackman E, Senne DA, Myers TJ, Bulaga LL, Garber LP, Perdue ML, Lohman K, Daum LT, Suarez DL: Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian ... a potent inhibitor of SARS coronavirus infection and spread Virol J 2005, 2:69 Yoshimura A, Kuroda K, Kawasaki K, Yamashina S, Maeda T, Ohnishi S: Infectious cell entry mechanism of influenza...

Ngày tải lên: 20/06/2014, 01:20