modulation of regulatory t cell proliferation conversion

báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps

báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps

... in the near future Abbreviations ACT, adoptive cell transfer Competing interests The authors declare that they have no competing interests Authors’ contributions Both authors wrote the article ... system shows tight drug-mediated regulation of growth over an extended time period Taking all these features into consideration, it is feasible that this new synthetic RNA-based regulatory system ... transducing primary human central memory T cells with this system In vitro results showed that the population of live central memory T cells increased by 24% and that apoptotic cell popu­ lation...

Ngày tải lên: 11/08/2014, 12:21

3 239 0
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

... NK cells initially-obtained their name due to their natural cytotoxicity against tumor cells requiring no prior sensitization, unlike T cells [4] It is well established that the cytotoxicity of ... excepting B cells that died within the first days of culture even in the absence of dendrimers (Data not shown) Given the fact that 3a-G1 inhibits CD4+ T cell proliferation without affecting NK cell ... dilution of purified CD4+ T cells stimulated with anti-CD3/CD28 coated beads c) Regulatory activity of 3a-G1 is restricted to T cells as under the same conditions IL-2 stimulated proliferation of...

Ngày tải lên: 18/06/2014, 15:20

13 404 0
Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

... directly to DCs may a new alternative of therapies for patients with allergic asthma These findings suggest that spleen DCs and Foxp3+Tregs prevents the generation and activation of Th2 effector cells ... mature phenotype and express a range of co-stimulatory molecules that are intermediate between immature and mature DCs, resulting in tolerogenic interaction with T cells in SIT We found that the ... significantly prevented by the vaccination with OVA-Fc-pcDNA3.1 Our pilot study showed that targeted DCs stimulated the proliferation of peripheral CD4+ T and CD8+ T cells in a concentration-dependent...

Ngày tải lên: 14/08/2014, 19:22

8 258 0
Báo cáo hóa học: "Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment" pptx

Báo cáo hóa học: "Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment" pptx

... with IFN-a 2b treatment may indeed contribute to the antitumor response A better understanding of the mechanism of action of IFN-a 2b may facilitate the development of treatment strategies to ... characteristics Patient characteristics are shown in Table for the 22 patients treated with IFN-a 2b, the 22 patients not treated with IFN-a 2b, and the 20 healthy subjects Of the 22 treated patients, ... duration of treatment for IFN-a 2b in the adjuvant treatment of melanoma The data presented support the earlier results of Cesana et al [28] and Tatsugami et al [29] suggesting Ascierto et al...

Ngày tải lên: 18/06/2014, 16:20

13 642 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... cell transplantation (HSCT) Studies in such patients indicate that Treg cells increase in response to the treatment, and that this effect seems to be increased with prolonged time of treatment [66] ... contribute to the onset of T1 D [53] These results suggest that an IL-2 functional deficiency in the target organ may disturb the positive feedback loop that controls Foxp3 stability, such that Treg ... frequency of Treg cells, it has not been elucidated yet whether or not quantitative or qualitative defects in T1 D auto-Ag specific Treg cells can be detected in the blood Thus, observations from the...

Ngày tải lên: 18/06/2014, 16:20

12 574 0
Báo cáo y học: " An association between the acute phase response and patterns of antigen induced T cell proliferation in juvenile idiopathic arthritis" ppt

Báo cáo y học: " An association between the acute phase response and patterns of antigen induced T cell proliferation in juvenile idiopathic arthritis" ppt

... recruitment of memory T cells into inflammatory sites [23] It is interesting that the antigens that induced vigorous SFMC proliferation in patients exhibiting a ‘restricted pattern’ were those ... memory T cells into the inflamed joint [7,10–12] In contrast, we found two distinct patterns of T cell antigen responsiveness: diverse and restricted proliferation Proliferation to all of the antigens ... total of 10 samples (22% of total samples) from 10 patients did not fit into either of these two patterns In these patients, proliferative responses to both streptolysin O and tetanus toxoid...

Ngày tải lên: 09/08/2014, 01:23

8 360 0
Báo cáo y học: "Emerging mechanisms of immune regulation: the extended B7 family and regulatory T cell" pdf

Báo cáo y học: "Emerging mechanisms of immune regulation: the extended B7 family and regulatory T cell" pdf

... translocation of CTLA-4 into the synapse is proportional to TCR signal strength [4] Hence, CTLA-4 might differentially restrict the expansion of T cells on the basis of the strength of the TCR signal ... be the last-ditch regulators and control the interaction between Teff and the peripheral tissues BTLA, B and T lymphocyte attenuator CD28/CTLA-4: more than just an on/off switch The CD28/CTLA-4 ... islet transplantation [59] It has recently been suggested that the major mechanism of action for CTLA4 Ig is not necessarily through the blockade of costimulation of T cells but through the induction...

Ngày tải lên: 09/08/2014, 01:24

7 338 0
Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx

Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx

... pathogen-free rodent facility at the National Institute of Dental and Craniofacial Research, National Institutes of Health All animal studies were performed according to National Institutes of ... inflammatory cell infiltration and bone destruction (Figure 1d) At the time of arthritis induction by SCW injection, therefore, administration of apoptotic cells significantly decreases the course of ... of arthritis occurrence and the severity of the disease, demonstrating the immunomodulatory properties of apoptotic cells Table Apoptotic cell injection prevents rats from SCW-induced arthritis...

Ngày tải lên: 09/08/2014, 14:22

8 310 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

... and evaluation and to analysis of T- cell proliferation PM contributed to the design of the study and to manuscript preparation All authors contributed to interpretation of the data All authors read ... reported that intravenous administration of the immortalized MSC cell line C3H1 0T1 /2 to immunized mice had no effect on the development of CIA [26] The treatment protocols and results of these studies ... resulted in the abrogation of the inhibition of Tcell proliferation by wild-type MSCs (Figure 3e) The addition of the IDO inhibitor 1-methyl-DL-tryptophan (1-MT) did not affect the inhibition...

Ngày tải lên: 12/08/2014, 11:23

11 464 0
Báo cáo y học: " FoxP3 and Bcl-xL cooperatively promote regulatory T cell persistence and prevention of arthritis development" ppt

Báo cáo y học: " FoxP3 and Bcl-xL cooperatively promote regulatory T cell persistence and prevention of arthritis development" ppt

... use of Tregs in the treatment of arthritis and their results indicate that adoptive cell transfer of Tregs can be used therapeutically in arthritis, such as CIA [24,32,40,41] A single transfer of ... long-term survival of Tregs Adoptive cell transfer of FoxP3 plus Bcl-xL-transduced Tregs prevents the development of collagen-induced arthritis To demonstrate that the gene transduction of FoxP3 ... [31] Moreover, it has been shown that adoptive cell transfer of Tregs can suppress arthritis [24,32] Therefore, we tested the hypothesis that co-transduction of CD4+ T cells with both FoxP3 and...

Ngày tải lên: 12/08/2014, 12:20

11 236 0
Báo cáo y học: "ATF3, an HTLV-1 bZip factor binding protein, promotes proliferation of adult T-cell leukemia cells" docx

Báo cáo y học: "ATF3, an HTLV-1 bZip factor binding protein, promotes proliferation of adult T-cell leukemia cells" docx

... directly and without ubiquitination, of some proteins that interact with HBZ [17] Thus, HBZ interacts with host factors and modulates their function, which is likely to contribute to persistent ... without interfering with the suppressive function of ATF3 These results suggest that ATF3 suppresses Taxmediated ATF/CRE-dependent transcription both of cellular genes and the HTLV-1 LTR ATF3 has ... ATL patient immunoprecipitation assay detected ATF3 bound to the proximal AP-1 site, but ATF3 bound to ATF site was non-specific (Figure 5E) Transient transfection of Jurkat T cells by electroporation...

Ngày tải lên: 13/08/2014, 01:20

12 195 0
Báo cáo y học: "Association between regulatory T cell activity and sepsis and outcome of severely burned patients: a prospective, observational study" doc

Báo cáo y học: "Association between regulatory T cell activity and sepsis and outcome of severely burned patients: a prospective, observational study" doc

... mortality of burned patients • This suggested that Treg might have a potential for suppressing the proliferation and cytokine production of T cells in vivo It also suggested that the regulation ... due to injury-induced CD4+ T cell activation However, we demonstrate here that the increased percentage of circulating Tregs in our burned patients was attributable to both T cell activation ... of Tregs among patients with various burn sizes Taken together, these data suggest that acute insults can induce or amplify CD4+CD25+ Tregs function and that CD4+CD25+ T cells contribute to the...

Ngày tải lên: 13/08/2014, 20:21

10 347 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

... primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively ... interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site...

Ngày tải lên: 07/03/2014, 16:20

9 485 0
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

... Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination (the time point associated with the ... concluded that hTERT p540 is not expressed or is cryptic on the surface of tumour cells and that immunization of cancer patients with hTERT p540 leads to the production of T cells that not recognize tumour ... with hTERT-pulsed DCs homing of the tumour-specific T cell populations to tumour sites contributes to the effectiveness of the antitumour immunity generated [85] Unfortunately, due to the limited...

Ngày tải lên: 18/06/2014, 15:20

23 439 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

... with a DNA vaccine result in CD8 + T cells that are more resilient to negative regulatory mechanisms that would otherwise impose restrictions on the expansion and activity of this key subset of ... would not result in a deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically ... effective at inducing cytotoxic T cells [14] DNA vaccine vectors offer several advantages, including the potential to elicit MHC class I-restricted immunity, reduced induction of anti-vector antibody...

Ngày tải lên: 18/06/2014, 16:20

11 506 0
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx

báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx

... Little to no mineralization was seen with other treatments collagen is not a major component of the proliferating cell, suggesting that FGF-2 stimulates proliferation partly through its ability ... population does not affect later osteogenic potential [35] of stem cells Therefore, an expansion of osteoblast cells by FGF-2 might be an excellent strategy for first stage re-population of a critical ... multi-step series of events modulated by an integrated cascade of gene expression that initially supports the proliferation stage The later mineralization stage is associated with the sequential...

Ngày tải lên: 20/06/2014, 04:20

8 547 0
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pdf

báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pdf

... Little to no mineralization was seen with other treatments collagen is not a major component of the proliferating cell, suggesting that FGF-2 stimulates proliferation partly through its ability ... population does not affect later osteogenic potential [35] of stem cells Therefore, an expansion of osteoblast cells by FGF-2 might be an excellent strategy for first stage re-population of a critical ... multi-step series of events modulated by an integrated cascade of gene expression that initially supports the proliferation stage The later mineralization stage is associated with the sequential...

Ngày tải lên: 20/06/2014, 07:20

8 460 0
Báo cáo y học: "Nature of Regulatory T Cells in the Context of Allergic Disease." ppsx

Báo cáo y học: "Nature of Regulatory T Cells in the Context of Allergic Disease." ppsx

... et al, Regulatory T Cells in the Context of Allergic Disease thus preventing the activation of mast cells and basophils IgG4 has been shown to reduce the IgE-mediated degranulation of these cells ... applicability that will have persistent clinical effectiveness that can be built within a short duration of therapy time.1 107 Early and Late Effects of SIT on Mast Cells, Basophils, and Eosinophils SIT ... required to elucidate the in vivo role of these cells and their subsets Effects of SIT on Dendritic Cells To understand the mechanisms of action of SIT, some cardinal steps should be explained The...

Ngày tải lên: 08/08/2014, 21:20

5 503 0
Báo cáo y học: "Patterns of Expression of Vaginal T-Cell Activation Markers during Estrogen-Maintained Vaginal Candidiasis" doc

Báo cáo y học: "Patterns of Expression of Vaginal T-Cell Activation Markers during Estrogen-Maintained Vaginal Candidiasis" doc

... show that persistent vaginal C albicans infection results in significant changes in the number, phenotypic profile, and state of activation of vaginal T cells Based on the temporal kinetics of ... experimental and control mice (data not shown) The mortality rate in the experimental group was insignificantly higher than that in the control groups (data not shown) The number of vaginal lymphocytes ... dendritic cell differentiation and activation J Immunol 2005;175:2666–75 Kametaka M, Kume A, Okada T, et al Reduction of CTLL-­ cytotoxic2 ity by induction of apoptosis with Fas-­ strogen receptor...

Ngày tải lên: 08/08/2014, 21:20

7 346 0
Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx

Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx

... rheumatoid synovium The essential factor in this situation appears to be the T cell- monocyte interaction to the extent that T- cell isolation renders the cells sensitive to apoptosis, while coculture ... apoptosis Coculturing of TTcells inin the presence of, but without direct contact with, monocytes rescues isolated T cells from glucocorticoid-induced apoptosis Graphs demonstrate that dexamethasone ... end-labeling of mediators contributes to the glucocorticoid-induced apoptosis-resistant phenotype of SF-derived T cells To confirm this, SF-isolated T cells were treated in vitro with different synthetic...

Ngày tải lên: 09/08/2014, 01:22

9 304 0
w