modelling in its elementary stage and the technique
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
Ngày tải lên :
05/09/2013, 09:08
... because the people were involved from the beginning of the installation and they understood the benefit of the option from the combination of hygiene education and their experience from the test ... continued the practice of emptying the contents of the pits in the drains beside the roads as well as in surrounding water bodies during nights, though they were educated those would cause the ... 100% of the cost of the cleaning of the connection system such as pipes and connection pits in the case of blockage At this stage, the regular maintenance and cleaning of the biogas plant itself...
- 9
- 971
- 0
The revolution in philosophy (II) - autonomy and the moral order
Ngày tải lên :
01/11/2013, 08:20
... the recognition of all duties as divine commands,” and the authority of moral duty itself rests on its having been instituted by the agents in the “kingdom of ends,” not from its being commanded ... this in the Metaphysics of Morals are not convincing on their own and require us to understand them in the full context of the rest of his ethical thought in Terry Pinkard, Kant, Citizenship, and ... virtuous in the right proportions (since the union of virtue and happiness demands a harmony of nature and freedom, which human agents are on their own incapable of bringing about) Both these are...
- 21
- 399
- 0
Tài liệu Committee on Toxicity of Chemicals in Food, Consumer Products and the Environment - Subgroup Report on the Lowermoor Water Pollution Incident pdf
Ngày tải lên :
17/02/2014, 10:20
... concentrations in Lowermoor treatment works and in trunk main system Indications of copper concentrations in the contaminated water Other water pollution incidents involving aluminium sulphate Key points ... 139 Introduction Aluminium Introduction General information The chemistry, absorption and bioavailability of aluminium The distribution of aluminium in the body The excretion of aluminium The ... markedly thereafter The proportion of iron samples exceeding the relevant 1984 WHO Guideline Value rose in the month after the incident and remained high to the end of 1990 On the basis of the toxicity...
- 448
- 3.7K
- 0
Advanced Modelling in Finance using Excel and VBA pot
Ngày tải lên :
24/03/2014, 04:20
... them The following sections explain matrix notation, and describe the operations of transposing, adding, multiplying and inverting matrices The examples illustrating these operations are in the ... Solver and analytic solutions As will become the norm in the remaining chapters, Solver is used both in the spreadsheet Advanced Modelling in Finance and automated in a VBA macro By using the array ... intervals (or ‘bins’), and then returns these frequencies in a vertical array The bins array is the set of intervals into which the values are grouped Since the function returns output in the form of...
- 278
- 1K
- 0
CONSTITUTIONS IN CRISIS Political Violence and the Rule of Law pptx
Ngày tải lên :
30/03/2014, 01:20
... of the principles; indeed, they might even misunderstand them The principles still apply to the terms of their agreement My thesis is that the activity of constitution making takes place within ... the life of the nation; the President must define and explain to Congress and the people the nature of this threat; the perception of the emergency, the judgment that the life of the nation is ... define and explain to Congress and the people the nature of the crisis—implies the continued constitutional status of both Congress and the presidency But once we suspend the Constitution, the...
- 285
- 378
- 0
aggarwal and conroy-price discovery in initial public offerings and the role of the lead underwriter
Ngày tải lên :
23/04/2014, 16:09
... preopening and remain in this state even at the end of the preopening period The wholesalers lock0cross the market in the hope that other market makers will change their quotes and therefore the ... of the typical 90-minute period for non-IPO stocks The lead underwriter starts the process by entering the first quote in the five-minute preopening window These preopening quotes are not binding ... approaches B Opening of Trading Interviews with investment bankers indicate that most of them wait for their Nasdaq trading desk to open trading in other stocks before they begin trading an IPO Therefore,...
- 20
- 361
- 0
thomas and patnaik-serial correlation in high-frequency data and the link with liquidity
Ngày tải lên :
24/04/2014, 00:23
... follow the solution adopted by Andersen and Bollerslev (1997) of ignoring the first return in the day, and then concatenating the data Trading intensity NSE has one of the highest trading intensities ... five minute interval, and the market closes at 4pm and opens at 10am, the interval between the last return on one day and the opening return of the next day would mean a gap of 216 intervals in ... value of one The graph shows two sets of confidence intervals, the inner intervals are for the 95% band and the outer ones are for the 99% bands The second graph shows the non-overlapping heteroskedasticity...
- 26
- 422
- 0
coupled vibrational modes in multiple filled skutterudites and the effects on lattice thermal conductivity reduction
Ngày tải lên :
06/05/2014, 08:53
... random and independent motions of the filling atoms, the coupled mode involves phase-matched relative motions of the host lattice and the filling atoms and disturbs phonon transport by scattering ... between the filled elements and the phonons in single and multiple filled skutterudites These studies allow determination of the effect of filling skutterudites with multiple elements and the role ... that the oscillations observed in the transient reflectance measurements are shifted from the low-energy Ag mode These oscillations are caused by the filling atoms and the coupling between the filling...
- 4
- 243
- 0
the healing flow artistic expression in therapy creative arts and the process of healing an imageword approach inquiry
Ngày tải lên :
01/06/2014, 10:52
... Considerations of the Healing-Flow Model and Interpretative Quilting In the metaphor at the beginning of this chapter, theory and text are like rock and water The rock contains and gives structure to the water ... metaphorical and theoretical perspective The integration into a coherent whole is a central theme in the Healing-Flow Model and the practice of art and research are intrinsically linked with each other In ... surroundings – the sounds of the roaring sea, the waves crashing against the rocky cliffs, and the wind in the trees – all faded into the background as she became more deeply absorbed by the immediacy...
- 253
- 610
- 0
hiding in plain sight steganography and the art of covert communication
Ngày tải lên :
03/07/2014, 16:10
... examine how well the company authenticated the information they receive back from the client, so I saved the page locally to my system Then I went in and changed the values to the following: ... criminal activities Crypto Lingo An understanding of cryptography begins with a basic understanding of some essential terminology: ■ ■ Plaintext refers to any type of information in its original, ... find the letter on the top row and replace it with the letter on the bottom row In this case “cat” would become “dbu” To translate “dbu” back into the original message, you find the letter in...
- 361
- 949
- 0
Báo cáo lâm nghiệp: "Effects of a clear-cut on the in situ nitrogen mineralisation and the nitrogen cycle in a 67-year-old Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) plantation" potx
Ngày tải lên :
08/08/2014, 01:21
... up Finally, at the beginning of October 1996, the quantity of resin in each cylinder was doubled by adding a second bag containing the corresponding resin type, in order to assess the efficiency ... were greater in the incubated soils than in the undisturbed soils, before and after the harvest Before the harvest, nitrate was the dominant form of mineral N in the incubated (75%) and undisturbed ... the cyl4 inders at the end of the incubation period – + T1 = final NO 3-N (or N H -N) content of the soil inside the cylinders at the end of the incubation period – For N O 3-N: T0fNO3 = T0fiNO3...
- 12
- 432
- 0
Báo cáo khao học: "The heritability of wood density components in Pinus pinaster Ait. and the implications for tree breeding" ppt
Ngày tải lên :
08/08/2014, 14:20
... Concerning Pinus pinaster wood, as early as 1970 Nicholls [31] began his article by complaining that “Although there are extensive stands of Pinus pinaster throughout the world there is surprisingly ... genetic and environmental factors in the variation of average ring density, and its components, and evaluating some implications for tree breeding MATERIALS AND METHODS The material, used in this ... through density In this context, the present investigation does not intend to be more than an initial study of the species, carried out with the aim of estimating, ring by ring, the relative contribution...
- 7
- 266
- 0
Báo cáo y học: "Changes in Two Point Discrimination and the law of mobility in Diabetes Mellitus patients" pps
Ngày tải lên :
10/08/2014, 10:20
... for finding STPD [11] An aesthesiometer is a modified form of vernier caliper useful for determining the TPD of touch, by moving the prongs into contact with the portion of the body part and then ... perceive one point rather than two points, the TPD is reached and this was recorded in the datasheet If the subject had callosity in any of the foot area, the TPD measurement was taken in the adjacent ... and thermoregulatory skin blood flow is observed in the toes but not the fingers of diabetic patients This could be directly related to the development of ulcers in the feet but not in the hands...
- 6
- 500
- 0
Báo cáo y học: " The characteristics of the synonymous codon usage in hepatitis B virus and the effects of host on the virus in codon usage pattern" ppsx
Ngày tải lên :
11/08/2014, 21:22
... the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they ... participated in the sequence alignment and drafted the manuscript., MLW and FXZ participated in the sequence alignment SDZ, GL and YW participated in the design of the study and performed the statistical ... The characteristics of the synonymous codon usage in hepatitis B virus and the effects of host on the virus in codon usage pattern Ming-ren Ma, Xiao-qin Ha*, Hui Ling, Mei-liang Wang, Fang-xin...
- 20
- 454
- 0
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
Ngày tải lên :
12/08/2014, 04:21
... designed and coordinated the study and carried out the genetic analysis All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) were used for amplifying the entire CP gene and the nucleotide sequences of the amplicons (917 bp) were then determined in both directions using the ... on the nucleotide sequence of the CP gene and the amino acid sequence of coat protein showed that all PVM isolates fell into two distinct groups - I and II (Table and Fig 3) PVM isolates in group...
- 7
- 452
- 0
Báo cáo y học: "A crucial role for tumor necrosis factor receptor 1 in synovial lining cells and the reticuloendothelial system in mediating experimental arthritis" pps
Ngày tải lên :
12/08/2014, 12:20
... not only in inflamed joints but also in the liver and spleen [13] However, the function of TNFR1 expression in these secondary lymphoid organs and its contribution to RA pathogenesis remain to be ... centrifuged for minutes at 1,000 g Murine IL-1β, IL-6, and TNFα levels were determined using the Luminex multianalyte technology and the BioPlex system in combination with BioPlex Mouse Cytokine Assays ... protection against cartilage destruction and a significant reduction in the amount of synovial inflammatory cell infiltrate and joint space inflammatory cell exudate (Figure 4c) TNFR1 silencing in the...
- 11
- 319
- 0
lin et al - national intellectual capital and the financial crisis in france, germany, ireland, and the united kingdom (2014)
Ngày tải lên :
01/11/2014, 16:23
... 3.34 Turning point and GDP growth enhancing and impeding factors of Ireland Turning point and GDP growth enhancing and impeding factors of the United Kingdom ... and housing investment to slide, thus brought further decline for business and industry along with increased losses on loans and financial investments at financial institutions In the wake of the ... and less exposure to the downturn in global demand than in some other countries (CIA 2012) The French economy began contracting in the second quarter of 2008 and continued declining through the...
- 132
- 557
- 0
a study on the prosodic features in responses via english and the equivalent expressions in vietnamese = nghiên cứu đặc điểm ngôn điệu trong sự phản hồi thông qua tiếng anh và sự thể hiện tương đương trong tiếng việ
Ngày tải lên :
02/03/2015, 14:22
... opinions, the utterances are taken note The utterances are used as examples in the first chapter and improvements for findings in the next one On the other hand, all the collected data are used in the ... falling rising tune indicates the given information In the responses in general and direct responses in particular, the intonation falling helps the hearers to reach new information in conversation ... show their indisposing in doing something by using falling tune: /ai ∂'gri:/ 1.4.3.2 Accentual function Intonation helps to mark certain syllables or words as prominent and therefore important in...
- 48
- 529
- 0