modeling the conformational properties of a highly flexible bacterial polysaccharide nmb
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc
Ngày tải lên :
23/03/2014, 10:20
... mechanism might be considered as an extracellular counterpart of the chemical inactivation of HNE that occurs intracellularly via GST and other enzymes that 5138 are abundantly expressed in nasal ... by the lachrymal and lingual salivary glands, and has been found to be expressed by several other secretory tissues such as prostate, mucosal glands of the tracheobronchial tree, nasal mucosa and ... m)1Æcm)1) after dilution in water AMA was from Sigma Aldrich (Milan, Italy) All other reagents, purchased from different companies, were of analytical grade Rabbit serum raised against HNE–protein adducts...
- 12
- 386
- 0
Báo cáo khoa học: Inhibitor-mediated stabilization of the conformational structure of a histone deacetylase-like amidohydrolase pptx
Ngày tải lên :
30/03/2014, 08:20
... well as zinc and potassium ions on the conformational stability of HDAH Two main denaturation phases of HDAH were differentiated The denaturation occurring at submolar concentrations of the denaturant ... Ray et al [31] and Chakrabarti et al [32], although the observed changes in the biophysical parameters were much smaller as compared with the denaturation of HDAH Saturating concentrations of ... intermediate in the absence of denaturant and the equilibrium meq value meq is a parameter which reflects the change in compactness of HDAH upon denaturation The parameter is proportional to the surface...
- 11
- 393
- 0
Báo cáo khoa học: Protein dissection enhances the amyloidogenic properties of a-lactalbumin potx
Ngày tải lên :
30/03/2014, 16:20
... 61–77 and 73–91 EDTA, the LA variants Th1-LA and desb-LA adopt a conformation similar to the MG state displayed by intact LA at low pH, retaining a native-like a- helical content (Fig 2A, B) Furthermore, ... from a solution of Th1-LA and desb-LA incubated at 35 °C pH 2.0 An extensive conformational rearrangement takes place during the aggregation process, as given by the disappearance of the a- helix ... An important aspect of this study is the analysis of the molecular features of LA and its derivatives at the initial stages of protein aggregation at pH 2.0 During the lag time, intact LA undergoes...
- 13
- 326
- 0
Báo cáo y học: " Genetic characterization of the complete genome of a highly divergent simian T-lymphotropic virus (STLV) type 3 from a wild Cercopithecus mona monkey" ppt
Ngày tải lên :
12/08/2014, 23:22
... CCA ACC CCA TCC CCA AGG PGPOLR1 GGY RTG IAR CCA RRC IAG KGG CCA 2687 P5GF2 AAA GGG CTA GCA ATT CAC CAC TGG P3GR1 GAT AGG GTT ATT GCC TGG TCC TTG ATA 1770 Outer 8699GF20 ACC CCC CCA GTA AGC ATC ... ATC CAG GCG PGPOLR1 GGY RTG IAR CCA RRC IAG KGG CCA 1360 8699GF21 AGA TGT CCT CCA GCA ATG CCA AAG PGPOLR2 GRY RGG IGT ICC TTT IGA GAC CCA 992 Outer 7867GPF2 TCC ACA GAA AAA ACC CAA TCC ACT 8699ETF2R ... gelada) [27], wild sacred baboons (Papio hamadryas) [25], wild hybrid baboons (P hamadryas X P anubis hybrid) [25,27], and captive Eritrean hamadryas baboons (P hamadryas) [19], which together...
- 17
- 231
- 0
Báo cáo y học: "Evaluation of the psychometric properties of a modified version of the Social Phobia Screening Questionnaire for use in adolescents" pdf
Ngày tải lên :
13/08/2014, 18:21
... lottery that was conducted in each class after all students had completed their questionnaires at the first and second assessment A case-control design was adopted for the evaluation of validity The ... the SPSQ-C, i.e a probable case of SAD, the student had to rate at least one potentially phobic situation as "marked fear" on the social fear scale This particular situation had to be consistently ... validity The overall test accuracy, i.e the percentage of correct diagnoses in the validity sample, was 84% The area under the curve (AUC) was 79 which was significant in comparison to a random...
- 7
- 371
- 0
Báo cáo khoa học: Conformational properties of bacterial DnaK and yeast mitochondrial Hsp70 Role of the divergent C-terminal a-helical subdomain pdf
Ngày tải lên :
16/03/2014, 22:20
... the primers: 5¢-CCCGCCATGGGTAAAATAATTGGTA TCG-3¢ and 5¢-CCCGGATCCAAGCTTTTACTGCTTAG TTTCACCAGA-3¢ The PCR fragments were cloned into the bacterial expression vector pTrc9 9A (Amersham Pharmacia ... interhelical interactions Thus, the sequence and conformational variability of the a- helical subdomain might be an important factor for maintaining the conformation of the whole PBD and modulating the ... physiological molar ratio [29,30] The steady-state ATPase activities of KKCC and KCCC were comparable with that of DnaK, however, addition of the NR peptide poorly enhanced their activity (less than twofold)...
- 13
- 349
- 0
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
Ngày tải lên :
18/02/2014, 16:20
... ratios: at a : Fe2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disappeared, and the resonance of Leu21 shifted At a : ratio, the resonances of residues 19 and 44 also disappeared, ... spectrum of CyaY, but the most striking consequence of the addition was the total disappearance of specific resonances without the concomitant appearance of other signals in other parts of the spectrum ... ⁄ iron ratio were again those of Arg20, Leu21, Asp22 and Asp23 At a : ratio, the above resonances disappeared completely, together with those of the amides of residues 29, 30 and 31 At a : protein...
- 12
- 704
- 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
Ngày tải lên :
19/02/2014, 17:20
... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... because these are the most distant pair of haems in the structure and are therefore expected to have the weakest interaction [33] The pH dependence of the chemical shifts of the NMR signals of the ... that the spectra are very similar with respect to chemical shifts of the signals in intermediate stages of oxidation, and that formation of the complex does not lead to a marked decrease of the...
- 10
- 640
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
Ngày tải lên :
21/02/2014, 15:20
... explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity against Gram-negative ... more antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and ... mastoparan gave the same results The role of LPS in the interaction was also demonstrated by the lack of effect of extracellular Mg2+ on the activity of the peptides against Gram-positive bacteria...
- 12
- 598
- 0
Báo cáo khoa học: Dissociation/association properties of a dodecameric cyclomaltodextrinase Effects of pH and salt concentration on the oligomeric state pot
Ngày tải lên :
07/03/2014, 12:20
... 5Â-AGTACATGTGGGACGTCAC CATGGAGTATGTCCC-3Â (forward) and 5Â-GGGACAT ACTC CATGGTGACGTCCCACATGTACT-3Â (reverse); for the H89V mutant, 5Â-TCTGCTGCAGCA GGGTGTT GAGAAGCGCTGGATG-3Â (forward) and 5Â-CATCCAG CGCTTCTCAACACCCT ... of change in the peak area shown in Fig 3A was estimated according to an equation of single exponential decay [7], peak areaịt ẳ Aekt ỵ B: From the equation above, the slope of the exponential ... obtained about the 3D structure of CDase I-5, the quaternary state of CDase I-5 was likely to be maintained by the intrinsic capability of the N- and C-terminal regions of the enzyme to form a...
- 13
- 511
- 0
Báo cáo khoa học: On the aggregation properties of FMRP – a link with the FXTAS syndrome? pot
Ngày tải lên :
14/03/2014, 23:20
... stain, as well as clustered deposits of fibrils with an average diameter of nm (Fig 6C) FX1RP Nt-NES aggregates have a curved appearance, with an apparent average diameter of 10 nm (Fig 6D) They ... microscopy analysis and Steve Howell for mass spectrometry analysis We are grateful to Cesira de Chiara and Laura Masino for critical discussion and assistance in graphic elaboration of CD results We acknowledge ... molecular assemblies When produced in isolation, they have an elevated tendency to self-associate To further characterize the nature of aggregation of FXR proteins, we have carried out a study of their...
- 10
- 415
- 0
Báo cáo Y học: The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components doc
Ngày tải lên :
18/03/2014, 01:20
... signal is not an artifact As regards the nature of the signal, the lack of a visible negative absorptionshaped peak at higher magnetic fields appears to be, at first glance, indicative of an axial ... 1/2) have already been partially characterized [8] One of these is a very narrow rhombic signal at g ¼ 2.00, 1.98 and 1.96 (in the following designated as g ¼ 1.98 signal) and the other, a characteristic ... that: (a) the FeFe cofactor is diamagnetic in the Na2S2O4reduced state containing 4FeII and 4FeIII centers, and (b) the main structural feature of the FeMoco, the central trigonal prismatic arrangement...
- 12
- 748
- 0
Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx
Ngày tải lên :
31/03/2014, 23:20
... reflect a conformational transition(s) towards a ferric HSA –haem state where slowly exchanging water molecules are far apart from the paramagnetic centre On the other hand, the lifetime of the ferric ... spectra of ferric HSA –haem in the absence and presence of ibuprofen and warfarin at pH 7.0 and 25.0 8C Electronic absorbance spectroscopy and 1H-NMR relaxometry indicate that the haem iron atom of ... in the presence of bezafibrate and clofibrate, which has been attributed to the shift of the conformational equilibrium towards the six-coordinated haem-iron state of ferrous HSA – haem-NO [8] The...
- 7
- 549
- 0
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
18/06/2014, 22:20
... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... it appears that the YxxΦ motif can also bind other adaptor protein complexes, like AP-1, and 4, and the differential binding to the different adaptors will determine the pathway of a cargo protein ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...
- 5
- 310
- 0
báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
20/06/2014, 04:20
... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... it appears that the YxxΦ motif can also bind other adaptor protein complexes, like AP-1, and 4, and the differential binding to the different adaptors will determine the pathway of a cargo protein ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...
- 5
- 365
- 0
báo cáo hóa học:" A review of the psychometric properties of the Health of the Nation Outcome Scales (HoNOS) family of measures" pptx
Ngày tải lên :
20/06/2014, 15:20
... service: An evaluation of HoNOSCA Australian and New Zealand Journal of Psychiatry 2001, 35:370-376 Yates P, Garralda ME, Higginson I: Paddington Complexity Scale and Health of the Nation Outcome Scales ... The reliability and validity of the Health of the Nation Outcome Scales: Validation in relation to patient derived measures Australian and New Zealand Journal Psychiatry 2000, 34:504-511 Issakidis ... C, Teesson M: Measurement of need for care: A trial of the Camberwell Assessment of Need and the Health of the Nation Outcome Scales Australian and New Zealand Journal Psychiatry 1999, 33:754-759...
- 12
- 646
- 0
Báo cáo hóa học: " Tuning the electronic properties of boron nitride nanotube by mechanical uni-axial deformation: a DFT study" docx
Ngày tải lên :
21/06/2014, 05:20
... increase under the larger strain However, the BO of the B-N bond parallel to the axial becomes smaller at larger strains The increase and decrease in the BO values for the slanted and parallel ... performed the data analyze YCW drafted the manuscript and participated in its design SPJ participated in the design of the study and conceived of the study All authors read and approved the final manuscript ... to the axial are shown as Bond-I Bond angles are labeled as A, B, C, and D Variation of (b) the radial buckling and bond lengths of (8,0) BNNT at different strains and (c) the radial buckling and...
- 11
- 408
- 0
Báo cáo lâm nghiệp:"The relationship between vegetation management and the wood and pulping properties of a Eucalyptus hybrid clone" pdf
Ngày tải lên :
08/08/2014, 01:21
... with a mean annual rainfall and temperature of 1144 mm and 22 °C respectively The trial was located at an elevation of 45 m on an east facing slope Soil parent material is of aeolian origin and ... important indicator of pulpwood quality Canonical Variate Analysis (CVA), also known as linear discriminant analysis, was used to make comparisons between the groups of variates rather than between ... treatments for selected wood and pulping properties as well as between the groups of variates for each treatment A summary of the analysis of variance and treatment means for tree growth and the...
- 8
- 387
- 0
báo cáo khoa học:" Effects of mode of administration (MOA) on the measurement properties of the EORTC QLQ-C30: a randomized study" pot
Ngày tải lên :
12/08/2014, 01:21
... and pain), single items (dyspnea, insomnia, anorexia, constipation, diarrhea, and financial impact), and global quality of life scale The questionnaire employs a one-week time frame and a mix of ... for the quality of patient ratings of HRQoL, were measured for the purpose of describing the sample of patients, as well as for assessing the quality of the randomization into three groups Characteristics ... of the patients included: indicators of health (i.e., the Karnofsky Performance Status scale [17]), treatment and disease Mean scores and standard deviations for the QLQ-C30 scales, as well as...
- 7
- 210
- 0
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx
Ngày tải lên :
12/08/2014, 01:22
... ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive ... CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific QPCR primer FAM-TTGGTATAGCACAATCTTCTACCAGAGGTGGC-TAMRA Sequence contains an EcoRI ... than the cotton rat [19], constitutes a more practical model due to the availability of a larger number of immunological and molecular reagents as well as the availability of transgenic animals...
- 11
- 348
- 0