mmm charts 6 a and 6 b

... trading passively by submitting nonmarketable “resting” limit orders and < /b> capturing a < /b> bid-ask spread Typically, traditional market 32 Nasdaq declared self-help against NYSE Arca at approximately ... depth is approximately level and < /b> balanced throughout most of the day at about 70 million standardized shares At 2:00 p.m both the buy and < /b> sell order books begin to decline, and < /b> then rapidly fall just ... could be automatically generated upon a < /b> market maker’s withdrawal from the market.35 When available liquidity for an ETF or stock was exhausted, marketable orders executed against stub quotes, and...

Ngày tải lên: 19/02/2014, 03:20

... PCR was carried out for 25 cycles of 30 s at 95 °C, 30 s at 55 °C and < /b> 30 s at 72 °C, using two primers 5¢-GGAATTCCATATGGGAGTCAAGACTGAGAA CAAC-3¢ and < /b> 5¢-CCGCTCGAGTCAACCTCCCGTCT G-3¢ The DNA products ... of a < /b> half-open b- barrel and < /b> two flanking a-< /b> helices, with secondary structure elements arranged as bbabbab in the sequence (Fig 1), identical to those of ubiquitin, SMT3 and < /b> SUMO-1 Fig 3B shows a < /b> ... 12–89 and < /b> ˚ ˚ 17–88, are 5 264< /b> A2< /b> and < /b> 4 866< /b> A2< /b> , respectively The first and < /b> most conserved interface is between molecules related by the crystallographic threefold axis ˚ ˚ The buried areas are 8 56 < /b> A2< /b> ...

Ngày tải lên: 16/03/2014, 18:20

... display the battery status Battery fully charged Battery half charged Change the battery If no information is displayed, either: c no battery is installed in the control unit, or; c an auxiliary ... E5139 9A < /b> Caution If the circuit breaker remains closed and < /b> the Ap LED remains on, contact the Schneider after-sales support department Fault indications Micrologic 7.0 A < /b> Caution The battery maintains ... circuit breaker c the maximum distance between the sensor and < /b> the circuit breaker is ten metres c earth-fault and < /b> neutral protection are independent and < /b> can therefore be combined Earth-fault pick-up...

Ngày tải lên: 05/07/2014, 10:20

... Low-Resolution-Mass Data HO O 5-33 C14H16O3 232.3 OH 373 AcO O O 5-32 C16H18O4 274.3 374 Appendix Low-Resolution-Mass Data AcO O OAc 5-35 C18H20O5 3 16.< /b> 3 375 AcO O 5-38 C18H20O6 332.3 OAc O 3 76 < /b> Appendix ... Low-Resolution-Mass Data 353 OH O 5-2 C18H14O3 278.3 O 354 Appendix Low-Resolution-Mass Data 355 O 5-4 C36H24O4 520 .6 < /b> O O O O O 5 -6 < /b> C36H24O4 520 .6 < /b> O O 3 56 < /b> Appendix Low-Resolution-Mass Data I OH 5-8 ... Low-Resolution-Mass Data 361< /b> O O O 5-13 C44H32O8 68< /b> 8.7 O O O O O 362< /b> Appendix Low-Resolution-Mass Data OTs 5-18 C20H17IO6S2 544.4 TsO I 363< /b> TsO OTs OBn 5-19 C53H44O13S4 1017.2 OTs OTs 364< /b> Appendix Low-Resolution-Mass...

Ngày tải lên: 10/09/2015, 15:50

... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a < /b> the b a < /b> c an d no article > b 50 That is eraser a < /b> the b a < /b> c an d no article ... the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 < /b> We are in same class a < /b> the b a < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over ... pounds from a < /b> bank a < /b> crime b criminal c criminally d criminality > b 178 your own business can cause a < /b> lot of financial worries a < /b> Manage b Managing c Manager d Manageable > b 179 The surgeons...

Ngày tải lên: 05/11/2012, 09:18

... climbing, backpacking, and < /b> adventure tourism Some recreational activities are made illegal such as gambling and < /b> drug use Research has shown that recreation contributes to life satisfaction, quality ... choosing a < /b> wife or a < /b> husband A < /b> of B on C in D with He left the gas on, ? A < /b> didn’t he B had he C was he D wasn’t he Michael took a < /b> photograph of Sandra while she A < /b> smiled B was smiling C had ... heavy fog have cancelled B All flights because of the heavy fog have been cancelled C All flights have cancelled because of the heavy fog D All flights have been cancelled because of the heavy fog...

Ngày tải lên: 02/07/2013, 01:25

... ACATGCTCCGAGA-3¢ and < /b> 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and < /b> ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and < /b> GAAGGCCAG 369< /b> 6 CTGTACATCAAGGA; alpha smooth muscle actin ... actin (a-< /b> SMA): AGCCAGTCGCCATCAGGAAC and < /b> CCGG AGCCATTGTCACACAC; and < /b> glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and < /b> 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining ... are as follows: IL- 1b: 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and < /b> 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a:< /b> 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and < /b> 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢...

Ngày tải lên: 18/02/2014, 04:20

... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and < /b> annealed to a < /b> prepared ... to as LlCBP3 3A)< /b> ; and < /b> a < /b> family 20 N-acetylhexosaminidase (LnbA) The chiA and < /b> yucG genes are separated by 19 bp in an operon starting with a < /b> putative transcriptional regulator positioned 166< /b> bp ... incubation FEBS Journal 2 76 < /b> (2009) 24022415 ê 2009 The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a-< /b> and < /b> b- chitin The degradation rates of a-< /b> and < /b> b- chitin were assayed...

Ngày tải lên: 18/02/2014, 08:20

... b1 ,3galactosidases, giving rise to a < /b> disaccharide and < /b> a < /b> monosaccharide, and < /b> was thus identified as a < /b> mixture of Galb1-4[Fuca1-3]GlcNAcb1-3Gal and < /b> Galb1-3[Fuca1-4]GlcNAcb1-3Gal The calculated amounts ... Galb1-4GlcNAcb1-3Gal NeuAca2-3Galb1-4GlcNAcb1-3Gal NeuAca2-3Galb1-4[Fuca1-3]GlcNAcb1-3Gal NeuAca2-3Galb1-3GlcNAcb1-3Gal NeuAca2-3Galb1-3[Fuca1-4]GlcNAcb1-3Gal Fig Secretion of Lewis antigens in ... gastrointestinal and < /b> pancreatic cells, counteracting the glycosylation pattern associated to malignancy We found in fact that NeuAca2-3Galb1-3[Fuca1-4]GlcNAcb1-3Gal and < /b> NeuAca2-3Galb1-3GlcNAcb1-3Gal are...

Ngày tải lên: 19/02/2014, 12:20

... synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and < /b> 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and < /b> 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b- globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and < /b> 5¢-ACACAACTGTGTTCACTAGC-3¢ ... 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and < /b> 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and < /b> 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ and < /b> 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP ... quantification was performed by nonsaturating picture scanning by a < /b> gel Doc 1000 Molecular Analyst apparatus (Biorad) Respiratory parameters and < /b> respiratory ratio in intact cells Respiratory parameters and...

Ngày tải lên: 06/03/2014, 09:22

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA -6,< /b> FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB -6,< /b> FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... (pCU1::fnbA+ D9,10 Cmr) P1 P1 spa P1 fnbA fnbB P1 fnbA fnbB spa Wild type spa::Kanr fnbA::Tetr fnbB::Ermr spa::Kanr fnbA::Tetr fnbB::Ermr P1 fnbA fnbB spa (pCU1 fnbA+) spa::Kanr fnbA::Tetr fnbB::Ermr ... BP Fn B- 7 BP Fn BBP Fn B- 9 BP B Fn -1 BP B1 1 G Provenza et al 66< /b> - 1.5 45 - 1.0 31 - 0.5 20 - Fn BR A < /b> G Fn ST BP Fn A-< /b> 1 BP Fn ABP Fn ABP Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP...

Ngày tải lên: 06/03/2014, 22:21

... distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available and < /b> revealed ... (Tubingen, Germany), and < /b> all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a-< /b> and < /b> b- domains The individual a-< /b> and < /b> b- domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA ... domain caused the disappearance of a < /b> large set of NOESY cross-peaks and < /b> the parallel appearance of another set of cross-peaks, until a < /b> clean 2D spectrum belonging to a < /b> single species was obtained...

Ngày tải lên: 07/03/2014, 09:20

... channels, and < /b> in particular with data obtained with b- PTH showing the formation of cationselective ion channels in artificial lipid bilayer membranes and < /b> in the plasmalemma of rat hippocampal ... min, and < /b> thereafter abundantly washed with dye-free solution before imaging and < /b> the addition of a1< /b> -PTH or PIN -a < /b> to the medium Cells imaged before (Aa) and < /b> after (Ab) exposure to 10 lM a1< /b> -PTH in a < /b> ... of blebs in the presence of a1< /b> -PTH is probably related to the membrane permeability changes it induces, as, in other neuronal cells, blebbing has been associated with raised intracellular Na+...

Ngày tải lên: 07/03/2014, 12:20

... (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> the BR quantum yield for the a < /b> subunits ... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2,...

Ngày tải lên: 16/03/2014, 14:20

... with goat polyclonal anti-cPLA2 -a < /b> and < /b> rabbit polyclonal anti-calreticulin sera, followed by donkey FITC-conjugated anti-sheep and < /b> donkey Texas Red-conjugated anti-rabbit sera Cells were visualized ... extracellular calcium Cells were then fixed and < /b> permeabilized and < /b> incubated with goat polyclonal anti-cPLA2 -a < /b> serum and < /b> mouse monoclonal antibodies against annexin V, annexin I, p11, caveolin, actin ... FEBS cPLA2 -a < /b> at its site of localization Several studies have also implied that cPLA2 -a < /b> may be regulated by cytoskeletal interactions Cytochalasin B, an inhibitor of actin polymerization, was...

Ngày tải lên: 16/03/2014, 18:20

... dribs and < /b> drabs and < /b> don’t want to have to pay for each trade you make although a < /b> number of brokerage houses, including Charles Schwab, TD Ameritrade, and < /b> Fidelity, allow customers to trade ... financial calculator, is also an accomplished writer who helps readers understand and < /b> make wise choices about their money His articles have appeared in many national publications, including AARP ... LIMITATION WARRANTIES OF FITNESS FOR A < /b> PARTICULAR PURPOSE NO WARRANTY MAY BE CREATED OR EXTENDED BY SALES OR PROMOTIONAL MATERIALS THE ADVICE AND < /b> STRATEGIES CONTAINED HEREIN MAY NOT BE SUITABLE...

Ngày tải lên: 16/03/2014, 21:20

... the wells not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only ... are broken, and < /b> the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> ... The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are...

Ngày tải lên: 19/03/2014, 22:32

... acid-containing galactolipids in Arabidopsis: jasmonate signaling dependence Plant Physiol 145, 165< /b> 8– 166< /b> 9 4472 47 Buseman CM, Tamura P, Sparks AA, Baughman EJ, Maatta S, Zhao J, Roth MR, Esch SW, Shah J, ... mass spectral data This work was supported in part by Grant 09-04-01023 -a < /b> from the Russian Foundation for Basic Research and < /b> a < /b> grant from the Russian Academy of Sciences (program ‘Molecular and < /b> ... sn1-O-(12-oxophytodienoyl)-sn2-O(hexadecatrienoyl)-monogalactosyl diglyceride, from Arabidopsis thaliana J Biol Chem 2 76,< /b> 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A < /b> and < /b> B, two new oxylipins from Arabidopsis...

Ngày tải lên: 23/03/2014, 05:22

... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed ... staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and < /b> vacuolar...

Ngày tải lên: 23/03/2014, 07:20

... Switzerland), CoomassieÒ brilliant blue R250 was obtained from Serva (Heidelberg, Germany), and < /b> disodium tetraborate decahydrate was obtained from Merck (Darmstadt, Germany) Sequencing grade modified ... in Arabidopsis thaliana Plant Physiol 108, 1505–1517 Oosawa N, Masuda T, Awai K, Fusada N, Shimada H, Ohta H & Takamiya K (2000) Identification and < /b> lightinduced expression of a < /b> novel gene of NADPH-protochlorophyllide ... and < /b> potassium alkali metal and < /b> various di- and < /b> tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A)< /b> In addition, the alkali metal adducts...

Ngày tải lên: 30/03/2014, 02:20