microscope image of a dichroic nanocomposite consisting of gold particles embedded in wood

Báo cáo khoa học: "Stratification, Blinding and Placebo Effect in a Randomized, Double Blind Placebo-controlled Clinical Trial of Gold Bead Implantation in Dogs with Hip Dysplasia" doc

Báo cáo khoa học: "Stratification, Blinding and Placebo Effect in a Randomized, Double Blind Placebo-controlled Clinical Trial of Gold Bead Implantation in Dogs with Hip Dysplasia" doc

Ngày tải lên : 12/08/2014, 15:21
... to investigate the effect of blinding and placebo in a controlled clinical trial of pain treatment in CHD Materials and methods Animals A total of 80 dogs recruited from all parts of Norway, ... Hielm-Bjorkman A, Raekallio M, Kuusela E, Saarto E, Markkola A, Tulamo RM: Double-blind evaluation of implants of gold wire at acupuncture points in the dog as a treatment for osteoarthritis induced ... clinical trial of canine hip dysplasia (CHD) with gold bead implantation or placebo treatment according to the main outcome variable, change in pain signs of CHD, versus the owner's guess of...
  • 12
  • 201
  • 0
Báo cáo y học: "A genomic approach to investigate developmental cell death in woody tissues of Populus trees" pot

Báo cáo y học: "A genomic approach to investigate developmental cell death in woody tissues of Populus trees" pot

Ngày tải lên : 14/08/2014, 14:21
... POPLAR.11658, AATCCCATGAATATTACCCCTAGA and TCTCTTGCATGGGTAGACATTTT for POPLAR.11639, ACCTCCATAGCCACCCAAG and CTGCAAGCTGATGCAGAAGT for POPLAR.11646, TGAACAGCAGGAGGTGTGAG and AACAGGTGTCCCCATCTGAG ... POPLAR.11624, and TGGCAACTCCAATGAAGAAC and CACCAACAGTTTATTTATTATTCAGATG for POPLAR.9335 Analysis of proteases in the POPULUSDB A list of Populus proteases was compiled, based on known protease ... ESTtotowereof Arabidopsisand4GenBankat thedata Theexpression sampleanalysis particularaccession(s) and Thetwo ratioannotationsArabidopsis and death(Bayesian (A) .fortotranscriptsaccordingcalculated death...
  • 14
  • 299
  • 0
Báo cáo hóa học: " Optical characterisation of silicon nanocrystals embedded in SiO2/Si3N4 hybrid matrix for third generation photovoltaics" doc

Báo cáo hóa học: " Optical characterisation of silicon nanocrystals embedded in SiO2/Si3N4 hybrid matrix for third generation photovoltaics" doc

Ngày tải lên : 20/06/2014, 23:20
... data on a point-by-point basis, which means each data point is analysed separately so that errors or noises present in particular points not affect the analysis of their neighbouring points; and ... thickness calculations in our analysis This approach was originally suggested by Hishikawa et al [15] and was realised in our calculation programme The fitting results indicate that the actual thickness ... direct/indirect character of the Si NCs is mixed Based on the absorption spectra, the materials appear to have an indirect band gap at about 1.90 eV, a quasi-direct band gap at 3.4 eV and a direct...
  • 6
  • 329
  • 0
It''''s made of gold-Possibilities Possibility In The Past potx

It''''s made of gold-Possibilities Possibility In The Past potx

Ngày tải lên : 12/07/2014, 03:20
... is made of china./It’s a china cup The spoon is made of metal./It’s a metal spoon The t-shirt is made of cotton./It’s a cotton t-shirt The vase is made of glass./It’s a glass vase The frames are ... John nói: Maybe you saw him at the market or Perhaps you saw him at the market or You might have seen him at the market NÓI VỀ CHẤT LIỆU The wallet is made of leather./It’s a leather wallet The ... or Maybe it will rain today ANNE He might have a neckband KHẢ NĂNG TRONG QUÁ KHỨ Khi ta dùng might để nói khứ ta dùng have I might have thrown the cup in the bin Điều ngh a bạn không...
  • 6
  • 432
  • 0
Báo cáo khoa học: "Two years follow-up study of the pain-relieving effect of gold bead implantation in dogs with hip-joint arthritis" docx

Báo cáo khoa học: "Two years follow-up study of the pain-relieving effect of gold bead implantation in dogs with hip-joint arthritis" docx

Ngày tải lên : 12/08/2014, 18:21
... Hielm-Bjorkman A, Raekallio M, Kuusela E, Saarto E, Markkola A, Tulamo RM: Double-blind evaluation of implants of gold wire at acupuncture points in the dog as a treatment for osteoarthritis induced ... Analysis of Variance (ANOVA), with repeated measurements and initial scores as covariate [16] Matched-pairs ANOVA model was used for analysis within groups For change within groups, cross-table analysis ... assessing osteoarthritis and clinical trials with agents claiming "chondromodulating" activity Osteoarthritis Cartilage 1994, 2:1-23 Altman DG: Comparing groups - continuous data In Practical statistics...
  • 7
  • 293
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 1

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 1

Ngày tải lên : 14/09/2015, 14:04
... made in this section The Raman spectra of Samples B and C annealed in forming gas are shown in Figure 4.6 and Figure 4.7 In contrast to the Raman spectra of the forming gas annealed Sample A, ... noteworthy Raman band for the sample annealed in N2 ambient (see Figure 4.1), the Raman spectra of Sample B and C annealed in N2 at same temperature are identical as comparing to the one annealed in the ... XTEM image of Sample A annealed at 800°C in forming gas (10% H2 + 90% N2) for 15 minutes Figure 4.3: XTEM image of Sample A annealed at 900°C in forming gas (10% H2 + 90% N2) for 15 minutes The inset...
  • 22
  • 316
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 2

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 2

Ngày tải lên : 14/09/2015, 14:04
... 700°C, after annealing for 15 minutes, a broad peak can be detected at ~289.4 cm-1 For the same annealing duration of 15 minutes, when the annealing temperature was increased to 800°C, a peak at ... such a material In this chapter, the results of an investigation on the effects of annealing temperature, annealing time and Ge concentration on the formation of Ge nanocrystals embedded in HfAlO ... concentration (at a particular annealing temperature) is the most important factor that determines the formation of the nanocrystals It has been also observed from the TEM image of a Sample C annealed at...
  • 23
  • 283
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 3

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 3

Ngày tải lên : 14/09/2015, 14:04
... matrix as a function temperature for Sample A, B and C annealed for 15 inset is the typical Raman spectra of as-grown and Ge nanocrystals nanocrystals of annealing minutes The free standing As ... the annealing time was increased from 15 to 60 minutes As such, the nanocrystals would grow and increase in number as the annealing duration increases, which causes an increase in P shown in Figure ... insignificant value gradually to 0.32 GPa as the annealing temperature increases from 600 to 800°C There is a sharp increase in the value of P to 1.52 GPa when the annealing temperature increases...
  • 18
  • 227
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 4

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 4

Ngày tải lên : 14/09/2015, 14:04
... fact that when annealed at 900 and 1000°C, Ge atoms are able to overcome kinetic limitations and enhance the nucleation and growth of the nanocrystals The XTEM images of samples furnace annealed ... nanocrystals at the same annealing temperatures The size variation of the nanocrystals is attributed to the much longer annealing duration of furnace annealing which assists the diffusion of Ge atoms ... Hydrostatic Pressure (P) experienced by Ge nanocrystals embedded in hafnium aluminium oxide matrix as a function of Ge concentration; the inset shows a set of typical Raman spectra of sample A annealed...
  • 23
  • 209
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 5

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 5

Ngày tải lên : 14/09/2015, 14:04
... Raman band at around 300cm-1 in Figure 8.3 (a) for both Sample A and Sample B In addition, the Raman peak positions of both set of samples exhibit a blue shift as the annealing temperature increases ... - Chapter Figure 8.3: Results & Discussions V (a) Raman spectra of Sample A and Sample B after the RTA; (b) summary of Raman peak position of annealed Sample A and Sample B It is interesting ... one annealed at 800°C, indicating coarsening has taken place The significant increase in the diffusivity of Ge is most likely due to the fact that the annealing temperature was near the melting...
  • 14
  • 223
  • 0
A Plasmonic Photocatalyst Consisting of Silver NanoparticlesEmbedded in Titanium Dioxide

A Plasmonic Photocatalyst Consisting of Silver NanoparticlesEmbedded in Titanium Dioxide

Ngày tải lên : 18/09/2013, 21:27
... a fourth approach, namely plasmonic photocatalysis The idea of plasmonic photocatalysis is as follows TiO2 of anatase phase is a semiconductor with a band gap of 3.26 eV,12 so near UV irradiation ... photocatalysis Similar ideas were already outlined in the past.14,15 For example the photoinduced charging and dark discharging of a silver core as a means to modulate the surface plasmon band of Ag@TiO2 ... a further cardinal advantage of the present device is the ability to fabricate it as a large area photocatalytic material J AM CHEM SOC VOL 130, NO 5, 2008 1679 Awazu et al ARTICLES Acknowledgment...
  • 5
  • 344
  • 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Ngày tải lên : 19/02/2014, 18:20
... Mori and T Baba (Institute for Advanced Biosciences, Keio University, Yamagata, Japan) Details on these strains in ASKA (a complete set of E coli K-12 ORF archive) library are available at http://ecoli ... removal of embedded ribonucleotides in chromosomal DNA during mammalian Okazaki fragment processing J Biol Chem 272, 22591–22599 Haruki M, Tsunaka Y, Morikawa M & Kanaya S (2002) Cleavage of a DNA-RNA-DNA ... maximal activity at pH 5.0 (Fig 5) On the other hand, the N-terminal RNase H domain showed no phosphatase 2831 A fusion protein consisting of RNase H and APase N Ohtani et al Table Phosphatase activity...
  • 10
  • 561
  • 1
solomon, breckon  -  fundamentals of digital image processing  a practical approach with examples in matlab 2011

solomon, breckon - fundamentals of digital image processing a practical approach with examples in matlab 2011

Ngày tải lên : 05/06/2014, 12:05
... this next as part of our examination of image storage formats 1.3 Image formats From a mathematical viewpoint, any meaningful 2-D array of numbers can be considered as an image In the real world, ... 8-bit integer images in the common image formats A fax (or facsimile) image is an example of a binary image Intensity or grey-scale images are 2-D arrays that assign one numerical value to each ... Example 1.2 Matlab code A imread(‘cameraman.tif ’); What is happening? %Read in intensity image imshow (A) ; %First display image using imshow imagesc (A) ; %Next display image using imagesc axis image; ...
  • 355
  • 1.4K
  • 0
báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc

báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc

Ngày tải lên : 19/06/2014, 08:20
... this article as: Tanaka et al., A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using ... Teine-ku, Sapporo, Japan and 3Department of Human Science and Informatics, School of Biological Science and Engineering, Tokai University, 5-1 Minamisawa, Minami-ku, Sapporo, Japan Received: 14 April ... images In Master's the-sis Industrial Engineering, University of Washington; 1993 Tanaka T, Nara H, Ino S, Ifukube T: Clinical Application of Head Mounted Display System for Left Unilateral Spatial...
  • 8
  • 538
  • 0
Báo cáo hóa học: " Evolutionary Techniques for Image Processing a Large Dataset of Early Drosophila Gene Expression" pptx

Báo cáo hóa học: " Evolutionary Techniques for Image Processing a Large Dataset of Early Drosophila Gene Expression" pptx

Ngày tải lên : 23/06/2014, 01:20
... , w and h are initial spatial coordinates, and w0 , h0 , A, B, C, and D are parameters The y-coordinate remains the same while the x-coordinate is transformed as a function of both coordinates ... Irkutsk, Russia His research interests are in computational biology and bioinformatics, web databases, data mining, artificial intelligence, evolutionary computations, animates, artificial life, and evolutionary ... RAW IMAGES Sources of variability in our images can be roughly subdivided into natural embryo variability in size and shape, natural expression pattern variability, errors of image processing...
  • 10
  • 255
  • 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

Ngày tải lên : 12/09/2012, 15:05
... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... greater access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager_data_lock call), the kernel issues a pager_data_unlock call The data manager ... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt...
  • 23
  • 1.3K
  • 1
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Ngày tải lên : 08/10/2012, 15:22
... be capable of handling, and searching in, information in a domain dependent way Search engines treat information domain-independently (they not store any meta-information about the context information ... observing a user's behaviour and trying to find patterns in it; Information Access and Management: Information access and management is an area of great activity, given the rise in popularity of ... in information " Bob Johnson, analyst at Dataquest Inc Using agents when looking for information has certain advantages compared to current methods, such as using a search engine: Search Engine...
  • 100
  • 811
  • 3
Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"

Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"

Ngày tải lên : 25/10/2012, 10:06
... health insurance companies in Germany Nearly 90% of the 82 million German inhabitants are members of a statutory health insurance company Although many such companies are quite small and represent ... conventional antipsychotics Stimulants included methylphenidate and amphetamine products Anticonvulsant-mood stabilizers (ATC-MS) included carbamazepine, divalproex/valproic acid, lamotrigine, gabapentin ... Netherlands and US rates were equivalent (0.9%) Table illustrates that there was a limited but disparate use of lithium (< 01% in German, 0.01% in Dutch and 0.15% in US youth) and antiparkinsonian agents...
  • 8
  • 488
  • 1
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

Ngày tải lên : 25/10/2012, 10:35
... at baseline Definition of adverse events and data extraction from ANZICS-APD The APD was interrogated using commercially available software (SAS for Windows; SAS Institute Inc., Cary, NC, USA) ... introduced an MET service using the first year of data as baseline and the second year as comparator Finally, an additional and similar analysis was performed for hospitals that had participated ... Response and Intervention Trial ANZICS-APD, Australian and New Zealand Intensive Care Society Adult Patient Database tals, and tertiary hospitals In these hospitals, data were obtained for the years...
  • 8
  • 639
  • 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

Ngày tải lên : 25/10/2012, 10:45
... Post-partum complications 10 Cardiovascular (congestive heart failure, cardiac arrest) Gastrointestinal complications* Other Sepsis Cardiovascular Gastrointestinal Gastrointestinal bleeding Liver ... fairly accurate in determining the placement of subclavian or internal jugular (IJ) vein pulmonary artery (PA) catheter introducer sheaths, but the clinicians were not accurate for clinical determination ... 26% of routine and 40% of non-routine films changed management In surgical patients with ICU stays shorter than 48 hours, a smaller percentage of routine CXRs (17%) resulted in a change in management...
  • 5
  • 506
  • 0