... (A–C) and MI (D) binding to membrane-bound Torpedo nAChR with indicated a-conotoxins and their analogs Final concentrations of the radioligand and toxin-binding sites of receptor were 280 and 230 ... peptides, and 125I-labeled GI was used as a tracer to test the SI and SIA analogs In these experiments the synthetic a-conotoxins GI, SI, SIA and MI were used as controls The respective ligand concentrations ... fitted to the Hill equation The IC50 and Hill coefficient (nH) values are 0.25 lM and 1.16 (n ¼ cells) for ImI, 15 lM and 0.62 (n ¼ 6) for [A10L,D14K]PnIA, 30 lM and 0.64 (n ¼ 7) for [A10L]PnIA in...
Ngày tải lên: 16/03/2014, 13:20
... with low power and status is indeed hazardous to your health, and conversely, having power and the control that comes with it prolongs life.5 Second, power, and the visibility and stature that ... mentor and boss, Sandy Weill, turned on him Arthur Blank and Bernard Marcus founded the large and successful home improvement company Home Depot after they were fired in the late 1970s from Handy ... you develop both the ability and the willingness to ask for things and that you learn to stand out People often don’t ask for what they want and are afraid of standing out too much because they...
Ngày tải lên: 27/07/2014, 13:50
báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt
... proteins and the positions of cysteine residues in region III and cysteine residues in region V are conserved Regions II and IV vary among the proteins Region II is comprised of between 114 and 174 ... contig #8, [GenBank: BQ805093], and one EST in contig #10, [GenBank: BQ806189] However, phred quality scores of 50, 42 and 42 for [GenBank: BQ805093] and 44, 42 and 42 for [GenBank: BQ806189] ... A sharonensis (1) and A tauschii (1), one was from the tetraploid T turgidum ssp dicoccoides, and one each was from the hexaploid T aestivum cvs Chinese Spring and Cheyenne and the synthetic...
Ngày tải lên: 12/08/2014, 03:21
Some people say that computers have made life easier and more convenient
Ngày tải lên: 04/10/2012, 10:25
Should arbitral awards that have been set aside be enforced in a different jurisdiction
... elsewhere based on local annulment standards ,and this trend may grow as international arbitration around the world becomes more transnational in character and less deferential towards the place ... effectively the country’s law on the recognition and enforcement of international arbitral award However, a state may also have, alongside the New York Convention and any other relevent treaties to which ... the entire award is set aside, the effect is, in theory ,that the entire award ceases to exist and cannot be enforced The more common position is that an award that has been set aside cannot...
Ngày tải lên: 07/11/2013, 09:59
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40 ... the endogenous yeast Ga protein subunit, Gpa1 Yeast Gpa1, Ste4 and Ste18 are structurally and functionally similar to mammalian Ga, b and c subunits, respectively [30] In many cases, this functional ... conditions for the production of the I7 OR in yeast and used biochemical and immunological methods to estimate the levels of receptor expression and its cellular localization Results Yeast transformations...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot
... concentrations of [125I]MIP-1a and cold MIP-1a or RANTES (1000 and 500-fold [125I]MIP-1a quantities) Unbound ligand was removed by filtration on BSA-presaturated GFB-filters (Whatman), and the filters were ... concentrations between 0.1 and 0.4 mM was added to liposomes (66 lM of lipid) containing N-NBD-PtdEth and N-Rh-PtdEth at time 0, and the fluorescence of N-NBD-PtdEth was measured and normalized to a ... ultracentrifugation The consecutive supernatants S1, S2 and S3 and the final proteoliposome pellet (PL) were analysed by Western blot and autoradiography, and show successful reconstitution of the protein,...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo khoa học: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases pdf
... showing altered substrate specificity and enhanced activity towards xenobiotics Results and Discussion Wild-type (GSTU1 and GSTU2) and mutant GSTs were expressed and purified as described in Experimental ... T7 promoter and T7 reverse primers In vitro expression and purification of sweet orange wild-type and mutant GSTs In vitro expression of functionally active GSTs, both wild types and mutants, ... properties of isoforms GSTU1 and GSTU2, and also to address questions regarding the functional roles of these H-site residues The results have both academic relevance and practical importance, as...
Ngày tải lên: 15/03/2014, 09:20
Chemical and functional components in different parts of rough rice (oryza sativa l[1] ) beforeandaftergermination
... after germination b- and c-tocopherol and a-tocotrienol were found The a- and b-tocotrienol content in brown rice increased from 0.78 and 0.02 mg/100 g before germination to 1.19 and 1.43 mg/100 g ... 1.28, 7.65, and 1.01 times, those of GABA increased 2.35, 1.69, and 2.23 times, and those part of c-oryzanol increased 1.13, 1.67, and 1.2 times, respectively The vitamin E, GABA, and c-oryzanol ... Fructose and sucrose were found before germination, and fructose and glucose found after germination Total free sugar content increased after germination Glucose which was absent in rough rice seed and...
Ngày tải lên: 15/03/2014, 15:42
Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc
... (lanes and 3), CD69NG70 (lanes and 5), CD69NV82 (lanes and 7) CD69NS84 (lanes and 9), rat CD69 (lanes 10 and 11) and mouse CD69 (lanes 12 and 13) was performed under nonreducing (even lanes) and ... solubility and stability among these proteins and allow us to select the human protein containing amino acids Gly70 to Lys199 (and the rat and mouse orthologs) as the most physically and biochemically ... buffer and is higher in the alkaline environment Thus, the unfolding temperatures at pH 6.8 or 7.8 were found to be 40 °C and 30 °C, 5592 respectively (Fig 2C and data not shown) On the other hand,...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Membrane distribution of epidermal growth factor receptors in cells expressing different gangliosides doc
... R24, goat anti-mouse IgG3 and finally with Alexa 546-conjugated donkey anti-goat Ig (pseudo-coloured green) C, G and K are merged images from A and B, E and F and I and J, respectively An enlargement ... (for EGFr analysis) or 10% (for GPI-YFP and VSVG-CFP) SDS–PAGE and analysed by Western blot The antibodies used were anti-EGFr and anti-GFP to reveal GPI-YFP and VSVG-CFP, respectively The positions ... with 10% (v/v) trichloroacetic acid, resuspended and subjected to SDS/PAGE and Western blot Materials and methods Chemical cross-linking Cell lines and DNA transfections The following CHO-K1 cell...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf
... washed and resuspended in 20 mM Tris/HCl (pH 7.4), mM MgCl2 and 200 mM sucrose Purity and intactness were analysed using marker enzymes, as described previously [25–27] Uptake of [a-32P]ADP and ... producing the higher expressed plant and mammalian AAC proteins (Fig 1) The undefined TB medium and the addition of pyruvate and malate stimulated the bacterial metabolism and led to the generation of ... after autoradiography and correspond to Rf values of unlabeled nucleotides visualized under UV light [23] Mitochondria were isolated from potato and Arabidopsis leaves and from potato tubers...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo khoa học: Correlation between functional and structural changes of reduced and oxidized trout hemoglobins I and IV at different pHs doc
... HbI and HbIV: iron(II)-HbI and met-HbI induce a 23.2 and 50.1% reduction of the peak intensity, respectively, when compared with the peak of the buffer Iron(II)-HbIV and metHbIV induce a 35.8 and ... Antonini, E & Brunori, M (1971) Hemoglobin and Myoglobin in Their Reactions with Ligands, p 10–11 North-Holland, Amsterdam, the Netherlands 14 Perutz, M.F., Sanders, J.K., Chenery, D.H., Noble, R.W., ... with our previous data [3] iron(II)-HbI (Figs 1B and 2B) and iron(II)-HbIV (Figs 1A and 2A) spectra in the range 250–470 nm show similar positive bands, resembling the dichroic characteristics of...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt
... P2Y receptor subtypes have been cloned and pharmacologically characterized Of these, P2Y2 responds to ATP and UTP, whereas P2Y1 and P2Y12 respond to ADP P2Y1 and P2Y2 receptors are both coupled ... h and examined the effect of such long-term serum starvation on cellular morphology, adhesion, proliferative and differentiation state, basal level of ERK1 ⁄ and Akt kinase phosphorylation, and ... and P2Y1 and P2Y12 receptor protein expression and functional activity Examination of the effects of specific pharmacological agents (a single agonist and two specific antagonists of P2Y1 and P2Y12...
Ngày tải lên: 30/03/2014, 08:20
An Account of Some of the Principal Slave Insurrections, and Others, Which Have Occurred, or Been Attempted, in the United States and Elsewhere, During the Last Two Centuries. pptx
... fields; and the liberty and equality doctrine, nonsensical and wicked as it is, (in this land of tyrants and slaves,) is for electioneering purposes sounding and resounding through our valleys and ... is one and uniform, and too explicit to be misunderstood It assures us, and writes the assurance in lines of blood, that the way of the transgressor is hard, and that though hand join in hand, ... war with Scotland, and most now married and living here, and about halfe so many Irish brought hither at several times as servants." The number of slaves at this period in the middle and southern...
Ngày tải lên: 31/03/2014, 11:20
Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc
... in 1975) [32] and the 2000 and 2001 viruses had infected various species including large felids [Fig and reference 6] for at least 28 years on both coasts and a midwestern state (and thus presumably ... isolation and molecular genetic studies, and MDB, CP, and CMH performed molecular genetic studies All authors read and approved the final manuscript Acknowledgements The authors thank Chris Anchor and ... higher (D = 1%); and comparing years 1998 with 2000 and 2001, distances were highest (D = 7% to 9% respectively) When the P-, F- and H- genes were combined into a single linear sequence and analyzed...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Research Article Superstability of Some Pexider-Type Functional Equation" pptx
... ggg , and C- and J-type Cf g , Cgf , Cgg , Cgh , C , and Jx , which are concerned with the hyperbolic cosine, sine, exponential functions, and Jensen equation Journal of Inequalities and Applications ... Applications 11 In papers Acz´ l 22 , Acz´ l and Dhombres 23 , Kannappan 24, 25 , and Kim and e e Kannappan 13 , we can find that the Wilson equation and the sine equations can be represented by ... x or f −x −g x , and k is of the form c E x − E∗ x , where A : G → C is an additive function, c ∈ E∗ 1/E x , and ,E:G → 3.10 ∗ is a homomorphism and 12 Journal of Inequalities and Applications...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: "GENERALIZED ORTHOGONAL STABILITY OF SOME FUNCTIONAL EQUATIONS" pot
... x ⊥ y, we derive x ≤ x + y and x ≤ x − y (for λ = and λ = −1, resp.), and analogously, from x + y ⊥ x − y, we derive x + y ≤ 2x and x + y ≤ 2y From these relations and the triangle inequality, ... with dim X ≥ and ⊥ is a binary relation on X such that (i) x ⊥ and ⊥ x for all x ∈ X; (ii) if x, y ∈ X \ {0} and x ⊥ y, then x and y are linearly independent; (iii) if x, y ∈ X and x ⊥ y, then ... (x) + f (y) (3.7) Justyna Sikorska 15 Now, using standard computations and the relations between x, y, x + y, and x − y for orthogonal vectors x and y, we get in case of the odd part of function...
Ngày tải lên: 22/06/2014, 21:20