micro nanopatterning of proteins using a nanoimprint based contact printing technique

... protein Page of Fabrication of the gold nanoisland substrate The gold nanoisland was prepared by the thermal evaporation on a glass substrate (0.8 × 7.0 cm) in a vacuum at a temperature of 65°C ... N, Yamamoto M, Kakiuchi T: Artificially phaseseparated binary self-assembled monolayers composed of 11-amino-1undecanethiolate and 10-carboxy-1-decanethiolate on Au(1 1): A comparative study of ... formation of aggregates in vitro Proc Natl Acad Sci USA 2003, 100:7021 26 Liu H, Zhang X, Gao Z: Lithography-free fabrication of large-area plasmonic nanostructures using colloidal gold nanoparticles...

Ngày tải lên: 21/06/2014, 04:20

... indication of discourse structure In the museum domain, each object description was treated as a separate segment; in the pharmaceutical domain, each subsection of a leaflet was treated as a separate ... Semantics of Definite and Indefinite Noun Phrases Ph.D thesis, University of Massachusetts at Amherst M Kameyama 1985 Zero Anaphora: The case of Japanese Ph.D thesis, Stanford University M Kameyama ... to automatically compute utterances according to the particular configuration of parameters chosen, and then to compute the CFs and the CB (if any) of each utterance on the basis of the anaphoric...

Ngày tải lên: 31/03/2014, 04:20

... nanoneedle (a) Carbon nanotube nanoneedle before Au nanoparticle coating and (b) after Au nanoparticle coating (scale bar: μm) (c) Magnified view of Au nanoparticle-coated nanoneedle (scale bar: ... real applications of micro- and nanoneedles, the needle must be attached to a supporting structure such as an AFM tip or a metal tip CNT can be easily attached to the end of a metal tip or an AFM ... interest factors to most biologists because changes in intracellular pH affect the ionization state of all weak acids and weak bases and thus potentially affect a wide array of biological processes...

Ngày tải lên: 21/06/2014, 04:20

... maps QMI2 is our approach using the neurobiologybased saliency model All values are in units of mm Dataset Dataset1 Dataset2 Dataset3 Dataset4 Dataset5 Dataset6 Dataset7 Dataset8 Dataset9 Dataset10 ... neurobiologybased saliency model All values are in units of degrees Dataset Dataset1 Dataset2 Dataset3 Dataset4 Dataset5 Dataset6 Dataset7 Dataset8 Dataset9 Dataset10 Average Error NMI (0,0,2.75) ... Section 2.4 and for each candidate transformation parameter, the QMI -based similarity measure (6) is calculated The candidate transformation parameters that give the maximum value of QMI are used...

Ngày tải lên: 21/06/2014, 16:20

... registration uncertainty as the standard deviation of the center of mass distance between the prostate gland (RV0) binary masks for each pair of registered images This measure has a clinical relevance ... study indicate that a standard deviation of approximately mm can be achieved in an automatic procedure Data from the CTbased study [23] indicate similar results, based on more registrations but ... ensure a successful registration An alternative approach is non-rigid image registration for treatment adaptation Chao et al [26] used deformable registration to warp a narrow shell and map contours...

Ngày tải lên: 09/08/2014, 09:20

... were also used to calculate the signal to noise ratio, which is a more statistically significant measure of the quality of an assay, as it includes standard deviation of the background as a parameter ... Proc Natl Acad Sci USA 2002, 99:6661-6666 Asante-Appiah E, Skalka AM: A metal-induced conformational change and activation of HIV-1 integrase J Biol Chem 1997, 272:16196-16205 Katz RA, DiCandeloro ... Landgraf et al [35] in development of a quantitative assay for PCR products The advantage of having biotin on both strands of the target DNA is that products of joining to either target DNA strand...

Ngày tải lên: 10/08/2014, 05:21

... used Each assay was performed in duplicate and each run included two negative controls Limits of detection and quantitation of the assay To establish the limit of quantitation (LOQ) of the assay, ... Republic of China 3Key Laboratory of Agricultural Genetics and Breeding, Shanghai Academy of Agricultural Sciences, 2901 Beidi Road, Shanghai, 201106, People’s Republic of China 4College of Life and ... SD, standard deviation; CV, Coefficient of variation using a TaqMan real-time PCR that detected a fragment of 269 bp Yang et al [16] have used SYBR Green I based on nucleotide sequences of ORF2...

Ngày tải lên: 11/08/2014, 21:21

... primers and probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The ... indicate the number of samples that generated similar data for both assays b,d indicate the number of samples that generated different data for the assays The TaqMan real-time PCR assay will be useful ... was labeled with 6carboxyfluorescein (FAM) at the 5’-end and with BHQ1 at the 3’-end Preparation of standard plasmid DNA PCR amplification of the NS1 gene was carried out in a reaction mix of...

Ngày tải lên: 12/08/2014, 02:20

... start out with the Real set of features, which is available after realization has completed, and thus all surface-oriented and morphological features are available Of course, we also assume that ... This information can be annotated reasonably reliably ( ) ¨ I¡   Voice (vox): Grammatical voice (active/passive) of antecedent and candidate This information can be annotated reliably ( ) H G ... Voice Feature (vox) Both active Antecedent active,candidate passive Antecedent passive, candidate active Both passive Syntactic Feature (syn) as appositive Comparative Other Subordination Conjunction...

Ngày tải lên: 08/03/2014, 05:20

... Liang Huang, and Qun Liu 2009 Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging - A Case Study In Proceedings of ACL 2009, pages 522-530 Wenbin Jiang and ... 2009 Automatic Adaptation of Annotation Standards for Dependency Parsing – Using Projected Treebank As Source Corpus In Proceedings of IWPT 2009, pages 25-28 Andr´ F T Martins, Dipanjan Das, Noah ... Romain Thibaux, and Dan Klein 2006 Learning Accurate, Compact, and Interpretable Tree Annotation In Proceedings of ACL 2006, pages 433-440 Slav Petrov, Pi-Chuan Chang, Michael Ringgaard, and...

Ngày tải lên: 17/03/2014, 00:20

... calculating the update Zhang and Clark compare aspects of transition -based and graph -based parsing, and end up using a transition -based parser with a combined transition -based/ second-order graph -based ... the transition -based strategy, the integrated algorithm we are looking for has to be transition -based at the top level The advantages of the graph -based approach – a more globally informed basis ... in the beam are recalculated based on a scoring model inspired by the graph -based parsing approach, i.e., taking complete factors into account as they become incrementally available As a consequence...

Ngày tải lên: 17/03/2014, 22:20

... a need for more, and better quality, data and this is particularly acute in the case of natural language data” and “learner corpora are a valuable addition to current SLA data sources” 2.1.3 ... with any significantly new information It was a significant advance when EA researchers to have placed the learner language (rather than L1 and L2) under examination A central consensus among EA ... abstracts in recent issues of journals such as this one [TESOL Quarterly] (and others such as Language Learning and IRAL) would indicate that the advocates of EA have prevailed and that EA currently...

Ngày tải lên: 24/03/2014, 19:20

... 34 Abdullah HA, Tarry C, Datta R, Mittal GS, Abderrahim M: A Dynamic Biomechanical Model to Assess and Monitor Robot-Assisted Therapy of Upper Limb Impairment” Journal of Rehabilitation Research ... that both groups had similar stages of motor impairment in the hand (Experimental, mean hand stage at admission 2.63 and at discharge 3.88 vs Control mean hand stage at admission 2.82 and at ... in age The covariates initial CAHAI and impairment score for the arm and hand and side of stroke were not significant for any outcome measure Age was a significant covariate for the outcome measures...

Ngày tải lên: 19/06/2014, 08:20

... obtained Table 2: An overview of the spatially adaptive compensation techniques Spatially adaptive compensation techniques van Roosmalen et al [5] Ohuchi et al [10] Kokaram et al [11] Jung et al ... Pixels with poorly estimated motion, Block -based spatial adaptation Spatial adaptation requires mixed block -based/ region -based frame partitioning The block -based part is illustrated in Figure Correction ... transformation independent of all other blocks A linear minimum mean-square error (LMMSE) estimator was used to obtain an estimate of the required parameters A block -based motion detector was also...

Ngày tải lên: 22/06/2014, 01:20

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... Lusi, E .A. , Passamano, M., Guarascio, P., Scarpa, A. , Schiavo, L., 2009 Analytical Chemistry 81, 2819–2822 Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan, ... The last set of experiments was conducted using human sera A human normal serum (which does not contain miRNA in detectable quantity) was diluted 50 times and used as a blank; it is referred as...

Ngày tải lên: 02/07/2014, 14:14

... American psychiatric Association: Diagnostic and Statistical manual of mental Disorders 4th edition Washington, DC, American psychiatric Association; 1994 Weissman MM, Bland RC, Canino GJ, Faravelli ... comparisons Chi-square and Fisher's exact test were used for analysis of categorical data Level of significance was set at 0.05 for all analysis Results Out of 874 approached people, 800 had completed ... NK, MA and DM drafted the manuscript All authors read and approved the final manuscript Page of (page number not for citation purposes) Annals of General Psychiatry 2007, 6:6 http://www.annals-general-psychiatry.com/content/6/1/6...

Ngày tải lên: 08/08/2014, 21:20

... occasions of MRI sagittal scans at medial tibial, lateral tibial and patellar sites as follows: grade 0, normal cartilage; grade 1, focal blistering and intracartilaginous low-signal intensity area ... coefficient of variation for cartilage volume measures was 2.1% for medial tibial, 2.2% for lateral tibial and 2.6% for patella [7] Knee bone size measurement Knee tibial plateau bone area and patellar ... baseline cartilage measures, tibial bone area, BMI and knee pain Cartilage loss is the hallmark of established OA, and 60% of cartilage is lost by end-stage knee OA [21,22] Cartilage loss is of the...

Ngày tải lên: 09/08/2014, 07:20

... Mori N, Kowa H, Nakashima K: Cosinor analysis of heart rate variability in ambulatory migraineurs Headache 2000, 40(6):457-63 29 Munakata M, Imai Y, Minami N, Sasaki S, Ichijyo T, Yoshizawa M, Sekino ... CA: The Statistical Analysis of Circadian Phase and Amplitude in Constant-Routine Core-Temperature Data J Biol Rhythms 1992, 7(3):177-202 17 Celec P: Analysis of rhythmic variance-ANORVA A new simple ... fundamental oscillations to generating additional maxima, minima or plateaus cn f Comparison method (Fourier ANOVA) A statistical test for comparing periodic patterns of grouped data is described...

Ngày tải lên: 10/08/2014, 09:20

... 190(2):478-500 17 Madzvamuse A, Thomas RDK, Maini PK, Wathen AJ: A numerical approach to the study of spatial pattern formation in the Ligaments of Arcoid Bivalves Bulletin of mathematical biology 2002, ... Bogotá, of Universidad Nacional de Colombia, under title Modelling in Mechanical and Biomedical Engineering, Phase II Author details Associate Professor, Mechanical and Mechatronics Engineering Department, ... on papillary patterns of human fingers Journal of Genetics 1924, 15(1):1-111 Hale A: Breadth of epidermal ridges in the human fetus and its relation to the growth of the hand and foot The Anatomical...

Ngày tải lên: 13/08/2014, 16:20