methods to minimize the energy of a 3d molecular structure

A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx

A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx

... with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients adds to unnecessary morbidity ... and Management of Diabetes in Canada [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management ... educational sessions for staff related to the clinical application of practice recommendations Senior administrators estimated that approximately 70 percent of staff typically attend 'usual' strategies...

Ngày tải lên: 11/08/2014, 05:21

10 521 0
báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx

báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx

... with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients adds to unnecessary morbidity ... and Management of Diabetes in Canada [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management ... educational sessions for staff related to the clinical application of practice recommendations Senior administrators estimated that approximately 70 percent of staff typically attend 'usual' strategies...

Ngày tải lên: 11/08/2014, 16:21

10 453 0
METHODS TO CHARACTERISE THE PERFORMANCE OF HEAD DISK INTERFACE USING a MULTIFUNCTIONAL SPINSTAND

METHODS TO CHARACTERISE THE PERFORMANCE OF HEAD DISK INTERFACE USING a MULTIFUNCTIONAL SPINSTAND

... failure analysis laboratory, quality analysis laboratory, as well as recording tests and demonstration As the areal density of HDDs approach Tb/in2, improved media testing and HDI characterization ... 350 RAMAC users with rental cost of $130 a month for a megabyte of storage Today, hard disk drive is the highest capacity non-volatile storage device which can store up to 600GB of data on a single ... relative to the position of linear stages A camera is positioned perpendicular to the plane of the disk media and guiding lines are drawn within the acquisition window to align the edge of the...

Ngày tải lên: 26/11/2015, 12:14

174 277 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

... have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar to ... predominantly classical ones We can find the explanation for this behaviour in the fact that these indicators are much easier to measure In addition, conventional methods have the advantage of being...

Ngày tải lên: 20/12/2013, 17:15

15 797 0
Ten Ways to Improve the Security of a New Computer doc

Ten Ways to Improve the Security of a New Computer doc

... daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware programs offer automatic ... automatic updating Enable that feature so your software always has the most current signatures If automatic updates aren’t offered, be sure to install the software from a reputable source, like the vendor’s ... sure to research these features before disabling or modifying them The AutoRun feature in Microsoft Windows systems was a default feature at the time of the Conficker malware and was one of the...

Ngày tải lên: 14/03/2014, 22:20

5 621 0
Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx

Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx

... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation of surface waters with respect to aragonite ... delineates ambitious priorities and goals for the National Ocean Acidification Program The FOARAM Act calls for the development of a detailed, 10-year strategic plan for the National Ocean Acidification...

Ngày tải lên: 15/03/2014, 15:20

163 401 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx

báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx

... Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will ... dominant language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface ... transcripts and develop an open coding schema based on a priori and emergent themes Each code condenses the data into analyzable units, ranging from a phrase to paragraphs They will then meet with the...

Ngày tải lên: 10/08/2014, 11:20

12 423 0
LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN

LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN

... HOW TO TELL THE SEX OF A BIRD THIS IS AMAZING !!! Until now I never fully understood how to tell the difference between Male and Female birds I always thought it had to be determined surgically ... now Below are two birds Study them closely See if you can spot which of the two is the Female It can be done Even by one with limited bird watching skills…! Send this to all of the men you ... watching skills…! Send this to all of the men you know, who could with a good laugh, and to all women who have a great sense of humor !!! Collection by FGMLGMU 06/03/2011 ...

Ngày tải lên: 22/10/2014, 20:00

4 466 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... of macromolecular organization of the mitochondrial proteome, comparatively little is known about the assembly pathway leading to the maturation of the cytochrome bc1 complex in the inner mitochondrial ... addition of the ISP to the bc1 sub-complex, a shift in the molecular mass from approximately 500 to 670 kDa occurs This change in the molecular mass is too large to be explained by the addition of ... On the other hand, in the transition from the 500 kDa band to the 670 kDa band, a structural rearrangement of the bc1 complex may occur due to the binding of ISP and Qcr10p, possibly leading to...

Ngày tải lên: 18/02/2014, 08:20

15 640 0
Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf

Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf

... know that the capacitance (stated in terms of the amount of charge (Q) stored at a given voltage drop (across the capacitor)) of a capacitor is given by (1) (Note that: the SI unit of capacitance ... is the farad; farad = coulomb per volt; typical capacitances are measured in microfarads or picofarads) 5.2.1 The Virtual Capacitor To implement the law of Coulomb, a TinyOS application was developed ... drain drain) to the USB power of the board The ADC (analog -to- digital converter) and DAC (digital -to- analog converter) lines are connected to DAC1 and ADC4 of the EE’s MSP430 Next, the DUT BATTERY...

Ngày tải lên: 21/06/2014, 11:20

12 524 1
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together...

Ngày tải lên: 24/09/2012, 17:19

88 986 8
Analytical study to minimize the engine exhaust emissions and safe knock limit of CNG powered four-stroke SI engine

Analytical study to minimize the engine exhaust emissions and safe knock limit of CNG powered four-stroke SI engine

... Mechanical Engineering Department of IT BHU Varanasi, India He has obtained his Ph.D from BHU Varanasi in year 2008 His major research area is I.C.Engines He has about years of teaching and research ... conditions of a natural gas engine Energy Conversion and Management 46 (2005) 121-138 [26] M.U Aslam, H.H Masjuki et al An experimental investigation of CNG as an alternative fuel for a retrofitted gasoline ... produced by variation in the position of the wall contact flame center and variation in the laminar flame speed at the spark center In Figure 3, the experimental and predicted results of NO and CO...

Ngày tải lên: 05/09/2013, 15:28

22 362 0
A computational study to investigate the effects of insulation and EGR in a diesel engine

A computational study to investigate the effects of insulation and EGR in a diesel engine

... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...

Ngày tải lên: 05/09/2013, 16:11

20 644 0
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english  a comparison

Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison

... situations It was found that the frequency of the use of the speech act of refusal by the Australian NSs of English was different from that by the VLEs Although the VLEs and the Australian NSs of ... Beebe et al (1987), more advanced learners are more affected by the refusal strategies of their native language, whereas the native language of the learners in Yagamashira’s study had more influence ... shift their refusal strategies noticeably according to the status of the interlocutors The above review of the related literature of the speech act of refusal shows that the use of refusal strategies...

Ngày tải lên: 07/09/2013, 13:31

44 1,2K 4
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

... can be measured via these same factors, even if the individual case is a strategy for which new tools are used The analysis revealed that one of the essential organizational factors, because of ... with their work The results are valued on a Likert scale of to for the different items Over the last few years, the average satisfaction index—calculated as the average of the values given to each ... leadership, and the adoption of a radical change model First, Irizar’s strategy was oriented towards To know, serve and add value for the customer’ For adaptation to the customer’s requirements, the...

Ngày tải lên: 24/01/2014, 00:20

10 1,1K 1
Tài liệu Exporting the Results of a Query to an Array pdf

Tài liệu Exporting the Results of a Query to an Array pdf

... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...

Ngày tải lên: 26/01/2014, 10:20

5 310 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... Approximately 70% of the model was built automatically After extending the Mse data to a resolution of ˚ 2.04 A, resolve built 76% of the protein model automatically The Mse–PhyK structure was ... purification The three distinct groups of HAPs are adapted to different habitats To support plant growth, bacteria not need to release phosphate as fast as the diges- tive tract of an animal host,...

Ngày tải lên: 16/02/2014, 09:20

13 766 0
Tài liệu Quantification of the Health Effects of Exposure to Air Pollution: Report of a WHO Working Group pdf

Tài liệu Quantification of the Health Effects of Exposure to Air Pollution: Report of a WHO Working Group pdf

... we can easily see that the total life-years for a given age-group and year has exactly the same value as the size of the mid-year population If both are calculated from exact dates of death, ... is an advantage to arrange the calculations in a two-dimensional array such as Table This is a schematic representation of the hazard rates each age-specific cohort will experience in each year ... each diagonal From this we calculate the number of deaths and the total life-years in each cell, as in Table We can this separately for each of the sexes These calculations are designed to quantify...

Ngày tải lên: 17/02/2014, 11:20

34 522 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
w