methods for identification of the deceased
báo cáo hóa học: " Evaluation of methods for extraction of the volitional EMG in dynamic hybrid muscle activation" pot
... evaluators for the performance of the various schemas These, however, are not the only possible evaluators For instance, Sennels et al [16] used other evaluators to test the success of their methods ... signal provides useful information about the muscle force developed under volitional muscle contraction In the time domain, the rectified EMG envelope has been widely used for various applications, ... Several methods were used for evaluation of the success of extraction of the volitional EMG The basic one was by visual inspection of the approximated signal which, despite not providing information...
- 11
- 602
- 0
Báo cáo y học: " Identification of the 15FRFG domain in HIV-1 Gag p6 essential for Vpr packaging into the virion" pdf
... p89.6/Pr(LF)a/R+ For p89.6/Pr- (Lxx)-/R+, PCR was performed with the p89.6/5' template and primer and primer GTACTACCCGGGAGGCCTTTATTCCTTGTCTATCGGCTCCTGC For p89.6/Pr-(l-23)/R+, PCR was performed with ... p89.6/HA-Ub/R+ For p89.6/Pr-/R+, PCR was performed with the p89.6/5' clone as the template [27], and primer GGTACATCAGGCCATCTCACC and primer CTGACCAGGCCTCCCGGGTTATTTTATTGTGACGAGGGGTCGTTGC For p89.6/ ... critical for Vpr virion packaging Since FxFG domains also occurs in nuclear pore proteins, the current finding also suggests for the first time that Vpr may recognize the same FxFG domain for both...
- 5
- 245
- 0
ITERATIVE METHODS FOR VARIATIONALINEQUALITIES OVER THE SET OF COMMONFIXED POINTS OF NONEXPANSIVE SEMIGROUPSON BANACH SPACES
... analyze implicit iterative methods for accretive variational inequalities based on hybrid steepest descent methods in uniformly convex Banach spaces whose norm is uniformly Gˆateaux differentiable ... corresponding explicit iterations of these implicit iterative methods for the same problem Suggest Browder–Tikhonov regularization methods for accretive variational inequalities and combine with inertial ... the results achieved on different methods for solving variational inequality (0.1) in a Hilbert space H, many authors have recently studied solution methods for variational inequalities in Banach...
- 27
- 277
- 0
USING THE ANALYTIC HIERARCHY PROCESS APPROACH FOR ASSESSMENT OF THE STRENGTH OF UNIVERSITY-INDUSTRY-GRI COOPERATION IN VIETNAM
... into Formal and Informal types Formal Cooperation Formal linkage refers to institutional built linkage Activities are carried out based on “contract or Memorandum of Understanding (MOU)" Formal ... General iv 16 linkage 4.2 AHP Model Formulation 16 4.3 The AHP Model for Overall Linkage 17 Figure I.3 : Hierarchy for overall linkage 18 4.4 The AHP Model for Individual Linkage 18 Figure I.4 ... Nazrul Islam for his invaluable advice and effort in guiding me at the first steps All the respondents and contributors for the work in data collection period in Vietnam are acknowledged for their...
- 73
- 495
- 2
Tài liệu Notes on the use of hand-held test devices for installation of the KRONE Cat.6 KM8 products doc
... Skew For further details please refer to the FLUKE documents Before you start a large-scale series of measurements go to the FLUKE homepage to see whether there are current drivers, etc for downloading: ... test devices for installation of the KRONE Cat.6 KM8 products December 2001 Page of 23 MICROTEST OMNIScanner2™ The MICROTEST OMNIScanner2™ performs all tests required by ISO/IEC 11801, for example: ... Skew For further details please refer to the MICROTEST documents Before you start a large-scale series of measurements go to the MICROTEST homepage to see whether there are current drivers, etc for...
- 9
- 602
- 0
The screening recommendations for cancer of the breast
... drawbacks of adding a yearly MRI There's no proof that MRI is an efficient screening tool for ladies of average risk - For ladies at high-risk, MRI screening must start at 30 An MRI ought to be employed ... examination every years with a medical expert in their healthcare - Breast self-exams aren't obligatory for ladies Request your personal doctor concerning the benefits of regular self-exams and together ... report any switch to their healthcare provider - Women having a lifetime chance of 20 % or greater for cancer of the breast ought to obtain an MRI and mammogram each year Women at moderate risk (15...
- 2
- 277
- 1
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... described in the present article were performed with 5Â form, and below we will refer to 5Â CBC-244 as CBC Spectral properties of CBC The coefcient of molar absorbance for rhodamine moiety of CBC was ... are presented as mean SD Bold type indicates the rate constant for CBC differing from the corresponding coefcients for Cbl *Data for H2OCbl and 57Co-labeled CNCbl from references [9,10,14,18] ... the simulations for k20)30 values presented in Table The data of CBC-based measurements (Table 1) showed a good correlation with the results obtained earlier for Cbls by different methods [10,14,18]...
- 12
- 603
- 0
Báo cáo khoa học: Copper-containing nitrite reductase fromPseudomonas chlororaphis DSM 50135 Evidence for modulation of the rate of intramolecular electron transfer through nitrite binding to the type 2 copper center pot
... forms are presented in Fig The turnover form was obtained by brief incubation of the dithionite reduced-form with substrate under anaerobic conditions, and probably corresponds to an enzyme form ... both type and T2Cu centers Therefore, in order to obtain reliable equilibrium redox potentials, we performed for the rst time an EPR monitored redox-titration for a copper-containing Nir The ... are also acidic, except for the Al xylosoxidans NCIB 11015 protein [1] The pI determined for Ps aureofaciens Cu-Nir is 6.05, which is clearly inside the interval obtained for the Cu-Nir in study...
- 9
- 393
- 0
Báo cáo khoa học: Saccharomyces cerevisiae Ybr004c and its human homologue are required for addition of the second mannose during glycosylphosphatidylinositol precursor assembly ppt
... and metabolic labeling was performed with 20 lCi [14C]ethanolamine for 23 h at 25 °C For radiolabeling of double mutant strains, cells were grown in SGlyYE medium for days at 25 °C, then grown ... biochemical function has been described for any Ybr004c protein, although its Drosophila homologue (termed ‘vegetable’) was identified in a screen for genes implicated in formation of the peripheral nervous ... SGalYE medium for 16 h and labeled for h at 30 °C with 15 lCi [3H]inositol or 50 lCi [3H]serine [14C]Ethanolamine labeling of the Dpsd1 ⁄ Dpsd2 ⁄ ybr004cD-pGAL-YBR004c strain was performed in the...
- 9
- 398
- 0
Báo cáo Y học: Identification of residues critical for activity of the wound-induced leucine aminopeptidase (LAP-A) of tomato pptx
... determined Measurements of Km and kcat for two mutant His6–LAP-As (R431K and E335D) were compared with values for the wild-type His6–LAP-A MATERIALS AND METHODS Site-directed mutagenesis The LapA1 ... Model for the tomato LAP-A active site The model of the tomato LAP-A active site is based on mechanisms proposed for the bovine LAP [22] and E coli PepA [24] Amino-acid residue coordinates for ... Relative activities of D347E, K354M, and R431K data were corrected for percentage enzyme that was in a hexameric form (see Materials and methods) ; all other enzymes were 100% hexamer Ó FEBS 2002
- 11
- 423
- 0
Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot
... and source are provided for each antibody used The amino acid numbering is for human sequences of APP695, APLP1650 and APLP2751 For antibody against rodent Ab, numbering is for the Ab sequence H, ... soluble C-terminally truncated form of APLP1 (APLP1s) It is unusual for a transmembrane protein to be found in a detergent-free aqueous environment One possible explanation for this behavior may be ... proteolysis necessary for ICD production This was accomplished by searching for endogenous ICDs in mouse brain and by the use of an in vitro ICD generation (ICDivg) assay For all three proteins,...
- 16
- 549
- 0
Impact of the Pension on Access to Health and Selected Food Stuffs for Pensioners of the Manonyane Community in Roma, Lesotho as Measured between 2004 and 2006 docx
... nutritional status for the pensioners • There is need for further investigation on this important issue of access to food and health services for pensioners, in order to obtain a generalization for the ... being cared for Many elderly people are therefore faced with the dilemma of either living alone or having to take care of very young, orphaned grandchildren.4,5 This demographic transformation ... with food insecurity Journal of Nutrition 1999;129:521S–4 Devereux S Forum for food security in Southern Africa: policy options for increasing the contribution of social protection to food security...
- 5
- 488
- 0
"ACCOUNTING FOR LIABILITIES OF THE FEDERAL GOVERNMENT" docx
... accompanying information" refers to unaudited information that accompanies the audited financial statements "Required supplementary stewardship information" is a new category of information FASAB ... Act means that, for certain types of events it is not necessary for the government to acknowledge financial responsibility separately for each individual event as is the case for events described ... for each accounting period (based on the same amortization method used to account for the related debt liability) for fixed value securities, and the amount of change in the current value for...
- 97
- 435
- 0
Báo cáo khoa học: TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides potx
... were determined for TL8 at 15 °C resulting in a kcat of 8.92 ± 1.2 min)1 An overview of hydrolysis to cyclization ratios is given for the investigated substrates in graphical form in Fig S5A–C ... thiocoraline, the sulfhydryl groups of l-Cys3 form a disulfide crossbridge minimizing conformational freedom to a great extent It can be assumed that the oxidative formation of the crossbridge is carried ... biochemicals, chemicals and general methods E coli Top10 was used as general host for subcloning and E coli M15 ⁄ pREP4 (Qiagen, Hilden, Germany) was used as host for heterologous expression of TioS...
- 13
- 466
- 0
Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx
... high-level expression vector pET21D-His in E coli, in which it formed inclusion bodies Therefore, the protein was subsequently expressed in soluble form in Antarctic P syringae (Fig S2) using the plasmid ... (72 lmolÆs)1) for the ATP-hydrolyzing activity of P syringae RecD is much higher than the reported value (5 lmolÆs)1) for mesophilic E coli RecD at 25 °C [3] The Km(DNA) (29 nm) for the P syringae ... as the template for amplifica- RecD helicase motif mutants tion In the second round, both N- and C-terminal fragments were purified, mixed together, and overlap PCR was performed for 10 cycles without...
- 17
- 326
- 0
Guideline for Management of the Clinical Stage 1 Renal Mass pptx
... support occupational risk factors for RCC development.4 Family history is associated with increased risk for RCC development, with inherited forms of RCC accounting for approximately two to four ... survival for conventional clear cell RCC.24, 56 For patients with pT1 clear cell lesions, the 5-year disease-specific survival (DSS) rate was 94.2% for patients with Grade 1-2 disease and 89.8% for ... has been used for treatment of prostate cancer for several years, its use for PN is a recent application Currently, only a few small, single-institution reports offer limited information regarding...
- 81
- 446
- 0
Standard Methods for Examination of Water & Wastewater_1 ppt
... confirmed MPNs and the fecal coliform MPN? BGB stands for “brilliant green bile broth” and EC stands for the medium for fecal coliform Solution: For the presumptive total coliform MPN, the three highest ... uniformly The dispersion will ensure a good spread of the colonies on the plate for easier counting The M-Endo medium is used for the coliform group and the M-FC medium for the fecal coliforms ... present may be necessary This is the case, for example, for limitations imposed on a discharge permit Generally, two methods are used to enumerate coliforms: the membrane-filter technique and the...
- 53
- 437
- 0
Standard Methods for Examination of Water & Wastewater_2 ppt
... discharge flow in the channel Using Equation (3.5) for the expression of yc and Equation (3.6) for the expression for Vc, the discharge flow equation for the rectangular weir becomes Q = 0.385 2gL ... in the form of a trapezoid As the flow passes through the trapezoid, it is being contracted; hence, the formula to be used ought to be the contracted weir formula; however, compensation for the ... exactly similar to that measured by rectangular weirs Thus, Figure 3.2 can be used for deriving the formula for triangular weirs The difference this time is that the cross-sectional area at the...
- 30
- 389
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose