method nematode phylogeny and gc content

... is extremely rapid and convenient: it allows determinations of nuclear DNA content [13] and of AT /GC base composition in a genome [15] Favre and Brown [ 12] developed a fast and simple flow cytometry ... 11] The GC content was then determined for the common beech and the tortuosa variety, after propidium iodide and mithramycin stainings Results are listed in table II In F sylvatica, the GC content ... order to estimate nuclear DNA content in the common beech, compared to three other beech varieties, as well as to evaluate its GC content accurate Materials and methods Four varieties were used:...

Ngày tải lên: 08/08/2014, 14:21

... integral to avoid doublets, as explained in a general review of the method by Marie and Brown (1993) Nuclear DNA content values and GC% were calculated from five to six different samples of 000-6 ... petraea 2C 1.6 pg (Band, 1984 in Bennett and Smith, 1991), 1.8 pg (Greilhuber, 1988) or 1.58 pg (Ohri and Ahuja, 1990), Q robur 2C= 1.59 pg (Ohri and Ahuja, 1990), 1.61 pg (Ohri and Ahuja, Q rubra ... base-specific dye and applying the fifth root relationship of Godelle et al (1993): RESULTS AND DISCUSSION Results are given in tableI They show a relatively uniform nuclear DNA content and base composition...

Ngày tải lên: 08/08/2014, 18:21

... hypotheses of BGC, TAMB and natural selection The BGC model suggests a positive correlation between GC content (including GC3 ) and recombination rates [46-50] We observed that GC3 was positively ... models of stem cell differentiation and the 'fold changes of gene expression' in each differentiation pair) and the molecular features (GC3 and genomic GC (GCg) content) of these Genome Biology ... substitution nucleotide GC3 changes GC3 recombination gene Fold and GCg gene gene between composition bination rate, offile expression are developmental-pivotal Levelsand datarate and andcorrelated with...

Ngày tải lên: 14/08/2014, 20:22

... urban area in Japan and agricultural drains when agricultural chemicals are applied In addition, analysis of agricultural chemicals by GC/ MS was simultaneously carried out and their ecotoxicity ... inhibition) ratio for daphnia and mortality ratio for fish in acute toxicity tests were used as water quality indexes - 225 - GC/ MS Analysis of Agricultural Chemicals GC/ MS analysis was applied ... cartridge similar to the preparation of samples for ecotoxicity test, and finally acetone solution was analyzed by GC/ MS RESULTS AND DISCUSSION Ecotoxicity Level of River Water Histograms of each...

Ngày tải lên: 05/09/2013, 10:15

... nsIRDFService datasources, resources, and literals It also registers and unregisters datasources and resources nsIRDFCompositeDataSource Allows the addition and removal of a datasource from a composite ... creation and other container-related functions Fires events when data is changed in a datasource Used for working with RDF/XML Functions are provided for parsing files and serializing content ... for working with datasources, resources, and literals, and is useful when you process RDF data nsIRDFService can be initialized by using the getService method of the rdf-service class: RDF = Components.classes[`@mozilla.org/rdf/rdfservice;1']...

Ngày tải lên: 21/01/2014, 06:20

... something } Built-in datasources that implement nsIRDFRemoteDataSource (and other necessary interfaces) and their own data handling include: @mozilla.org/rdf/datasource;1?name=history @mozilla.org/browser/bookmarks-service;1 ... interface facilitates the creation of containers and provides other container-related functions It provides functions that make and work with a sequence, bag, and alternative (The functions work the same ... briefly here Besides being abstract and confusing, these interfaces require a lot of error handling to work correctly Fortunately, a library on mozdev.org called JSLib handles RDF file access The JSLib...

Ngày tải lên: 21/01/2014, 06:20

... represent the datasource itself (gRDF = new RDFFile), methods that view and update the data (if(gRDF.getAttribute(tempItem,'name')==name), and utilities that make work with RDF files easier (path ... by using the path and a root resource identifier, and the "xFly" namespace is used for the data references Example 10-14 shows that the RDF file is ready to have its data added and deleted Example ... easily This is where RDF and dynamic overlays come in The RDF you provide in your package makes it possible for the chrome registry, discussed in Chapter 6, to find, understand, and register your new...

Ngày tải lên: 21/01/2014, 06:20

... Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; ... Ab(1–40) and Ab(M1–40) are at least 97% pure In the lanes containing Ab(1–42) and Ab(M1– 42), there were prominent bands at approximately kDa and faint bands at approximately 14 kDa The band at ... Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained...

Ngày tải lên: 18/02/2014, 13:20

... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for ... physiological functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis ... these cells Mesenteric BECs and LECs (Fig 5A,B) were also obtained by the same strategy as illustrated in Figs and 4, and were treated with VEGF-A or VEGF-C (Fig 5C) MAPK and Akt phosphorylation...

Ngày tải lên: 18/02/2014, 17:20

... GGCAGAGCACTTCAT-3¢; putative mucin TcMUCII (Tc00.1047053506131.20), F, 5¢-GCGGAGAACAAGATG AGGA-3¢; R, 5¢-TCGCTTTTGAAATAGGCACC-3¢; hypothetical protein (Tc00.1047053509891.40), F, 5¢-GCCG TCATGCAAAAATATCC-3¢; ... and proteins from the supernatant fraction (SP) were resolved by SDS ⁄ PAGE and visualized by silver staining (D) Western blot analysis of IP and SP samples, obtained with pre-immune serum, and ... sodium carbonate and 0.05% formaldehyde Staining was stopped in 50% ethanol and 12% acetic acid for For western blot analysis, IP and SP samples were separated on a 13% SDS ⁄ PAGE gel and transferred...

Ngày tải lên: 15/03/2014, 23:20

... consumption with Cd and Pb contents in the cereals Both data on the rice and wheat consumption ŽMinistry of Health and Welfare, 2000 and that on Cd and Pb contents in rice and wheat ŽTable are ... rice and wheat are cited from Ministry of Health and Welfare Ž2000., and Cd contents in rice and wheat are cited from the raw rice and flour columns in Table c The average value for Kanto I and ... intake of 8.2 and 1.8 ␮g Cdrday via rice and wheat, respectively, accounts for 32 and 7% of the total dietary Cd intake Pb contents are more or less similar in rice and in wheat, and contribution...

Ngày tải lên: 15/03/2014, 23:22

... intermediary metabolism, i.e ME, ICDH, G6PDH and GDH Materials and methods Plant growth and plant samples analysis Plant growth conditions, measurements and analysis, were performed as described ... In contrast, a linear ratio between fresh and dry weights with increasing Cd contents in plant tissues shows that water content and dry matter in leaves and roots were not significantly changed ... FW was then maintained Protein contents Enzyme activities and isoenzyme analysis The total soluble protein content was examined in leaf and root samples Roots and L4 showed no significant changes...

Ngày tải lên: 15/03/2014, 23:22

... Ritz method (Heat balance integral method Goodman’s 3.3.2 Rayleigh–Ritz method (Variational method) 3.3.3 The method of weighted residuals 3.3.4 Galerkin finite element method ... Fundamentals of the Finite Element Method for Heat and Fluid Flow Fundamentals of the Finite Element Method for Heat and Fluid Flow Roland W Lewis University of Wales Swansea, UK Perumal ... filament and the gas; hg , the heat transfer coefficient between the gas and wall; hw , the heat transfer coefficient between the wall and ambient and is the emissivity The subscripts f, w, g and a...

Ngày tải lên: 17/03/2014, 13:53

... teaching methods question (Problem based learning): definition, purpose, methods, benefits, meaning, scope, advantages and difficulties in teaching this method + To apply these teaching methods ... This work will help us see clearly what content should be put on lectures and not content May include an analysis, one that reflects the needs and the methods used Using the This section indicates ... materials and construction sequence and describe what students did) and indirect methods of teaching, in that teachers set more general goals, using a variety of learning materials and allow...

Ngày tải lên: 22/03/2014, 09:20

... arranges and oversees the recording, handles mixdowns and edits, coaches the artists, pays for studio time and recording media (e.g digital tape, to which masters are often still recorded), and/ or handles ... synthesizers and sequencers, such as Reason and Fruityloops, are increasingly coming into use, and digital multi-tracking software, such as Nuendo and Pro Tools have, for practical and financial ... communities in the UK and the US, and with the international popularity of Bob Marley and other artists Copyright practice, however, continued to be informal and irregular Both composers and performers...

Ngày tải lên: 23/03/2014, 13:20

... sa j , t j 1 A j 1  Here, t j (and resp si ) denotes the jth (and resp ith) character in wT (and resp wS) and A  a1m is the hidden alignment between wT and wS where t j is aligned to sa j ... time series and transliteration model was proposed in (Klementiev and Roth, 2006), and extended for NETE mining for several languages in (Saravanan and Kumaran, 2007) However, such methods miss ...   ; // Set of candidates for εS for each candidate eT in DT score = TransliterationSimilarity(εS, eT, MT) ; if (score ≥ β) then YS  YS  (eT , score) ; end εT = BestScoringCandidate(YS) ; 10...

Ngày tải lên: 24/03/2014, 03:20

... 59 5.5 2 Relationships between Sx and s2 , Sx and s2 x x 59 Oddities: Random number and precision problems 63 6.1 Random number artefacts ... 20 Discrete random variables 21 Random Number Generation 25 3.1 Linear congruential random number generators 26 3.2 Long sequence random number generators ... Carlo Methods being taught at the Department of Nuclear Engineering and Radiological Sciences at the University of Michigan AFB, February 11, 2000 i ii Contents What is the Monte Carlo method? ...

Ngày tải lên: 09/04/2014, 16:23

... headings, graphics, and charts L.N.2.4.4 Make connections between a text and the content of graphics and charts L.N.2.4.5 Analyze and evaluate how graphics and charts clarify, simplify, and organize ... explain, and/ or interpret bias and propaganda techniques in nonfictional text L.N.2.5.5 Explain, describe, and/ or analyze the effectiveness of bias (explicit and implicit) and propaganda techniques ... Eligible Content “Note” content exclusions or definable range of the Eligible Content How the K–12 Pennsylvania Common Core Standards affect this document? Assessment Anchor and Eligible Content...

Ngày tải lên: 02/06/2014, 09:48

... participants' sleep and to evaluate the content validity of both of these measures in the FM patient population Methods Participants Eligible patients were between the ages of 18 and 65 years (inclusive), ... frequency, and location of their pain Recruitment took place in August and September of 2008 and for each round of interviews, efforts were made to recruit participants diverse in gender, race, and ... a significant and negative impact, including their mood, family and social relationships, and work productivity One participant stated that "it affects every aspect of your life" and that it was...

Ngày tải lên: 18/06/2014, 18:20

... et al measured band power from 64 channels, from both hemispheres and two different bands simultaneously, with each band controlling a different dimension of the cursor movement, and with the two ... NeuroEngineering and Rehabilitation 2009, 6:14 Once the optimum location and band were identified, each subject repeated the threshold-setting task, and the power in the optimum location/band was again ... of C1, C3A, C5, and C3P, each of which was about cm from C3, and calculated band power on C3 for the referenced signal To determine the optimum spatial location and frequency band for discrimination,...

Ngày tải lên: 19/06/2014, 08:20