metabolic consequences of changes in gene expression

Báo cáo y học: "The Proteomic Code: a molecular recognition code for proteins" docx

Báo cáo y học: "The Proteomic Code: a molecular recognition code for proteins" docx

... even the antibodies generated against the original interacting domains; even P_ab-P/ c_ab, i.e., antibodies against interacting proteins, will themselves contain interacting domains They are idiotypes ... studies of the 3D structures of proteins give some ideas of how interacting interfaces look (Figure 8): - the interacting (co-locating) sequences are short (1–10 amino acid long); - the interacting ... expression library of the expressed target protein is created for screening for query protein/target protein affinity binding When binding complexes are found to meet the affinity binding lev- http://www.tbiomed.com/content/4/1/45...

Ngày tải lên: 13/08/2014, 16:21

44 418 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

... and changes in its expression during seed development are described In addition, our 400 data suggest that GmPDIM and proglycinin or b-conglycinin associate during the course of the folding process ... form of the b-conglycinin a¢ subunit in the ER in the presence of tunicamycin Discussion In this study, we cloned the cDNA of GmPDIM and characterized it as a member of the PDI family of proteins ... development in soybean cotyledon cells [12] Approximately 70% of seed-storage proteins are composed of the two major globulins glycinin and b-conglycinin They are folded and assembled into trimers in...

Ngày tải lên: 30/03/2014, 04:20

12 348 0
Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc

Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc

... transformed into logarithmic scaling and linear lines instead of curves are resulting for constant values of the creatinine clearance In that way figure was constructed and the interrelation of the ... the exception of creatinine Creatinine was added to the perfusate for the purpose of determination of the exogenous creatinine clearance, resulting in 3–4 fold concentration levels in comparison ... control Figure The U/P quotient of creatinine U/Pcrea versus of creatinine; for isolated kidney water reabsorption) The U/P quotient of creatinine U/Pcrea versus urine flow VU for isolated kidney...

Ngày tải lên: 20/06/2014, 00:20

13 548 0
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

... corresponding to the lower and upper frequencies of the bandwidth of the information being transmitted In addition, it should be noted that dividing or multiplying a signal in the time domain also ... transceivers In August 2002, he joined the faculty of Auburn University, where he is currently an Associate Professor in electrical and computer engineering His research interests include VLSI ... Cavin received a BSEE from Virginia Tech in 1988 and MSEE in 1991 from the University of Central Florida Following completion of BSEE he worked at David Taylor Research Center in the area of...

Ngày tải lên: 22/06/2014, 22:20

11 417 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... 5¢)3¢ orientation VK1.link VK2.link VK3.link VK4.link VK5.link VK6.link VL1.link VL2.link VL3b.link VL3a.link VL4.link VL5.link VL6.link JH1-2.link JH3.link JH4-5.link JH6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC ... in the CDR3 (Val101Phe) of the heavy chain might also be important for binding to the toxin The change of Val to Phe may result in a better interaction in terms of an increased contact area Changes ... a consequence of directed evolution [36] or shortening of the linker peptide (unpublished results), resulted in an improvement in the stability of the single chain The diabodies of evolved clones...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... primer binding site had a perfect match Lineage II Lineage IV Lineage III s u b s t itu t io n s / s it e Figure otype G1 of tree showing Phylogenetic rotaviruses the four lineages described in genPhylogenetic ... years it was reported that the accumulation of point mutations in VP4 and VP7 genes was the main cause of the failure of the G or P-typing of rotavirus strains [7,8,12,16-21] At least, there are four ... strains detected in Hungary provides evidence for genetic heterogeneity within the P[6] VP4 gene J Clin Microbiol 2004, 42:4338-4343 Bok K, Matson DO, Gomez JA: Genetic variation of capsid protein...

Ngày tải lên: 20/06/2014, 01:20

4 329 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc

Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc

... the Structured Clinical Interview for DSM-IV, being clinically stable (defined as having had no changes in severity or new treatments initiated in the last month), and taking a single oral antipsychotic ... afford greater insight in describing and grading the impact of side effects associated to antipsychotic drugs [15,16] A brief instrument is preferred for use in clinical practice and in investigations ... results with Page of the original version to ensure conceptual equivalence (intermediate version 2.0) Finally, all the expert translators participated in the proof reading test of the intermediate...

Ngày tải lên: 09/08/2014, 01:21

8 477 0
Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt

Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt

... Hutchinson NI: Discoordinate expression of stromelysin, collagenase, and tissue inhibitor of metalloproteinases-1 in rheumatoid human synovial fibroblasts Synergistic effects of interleukin-1 ... in processes of tissue remodelling, including wound healing and angiogenesis, but also in cancer invasion and inflammatory joint destruction [31,32] R204 Similarly to other recent investigations ... damage in the first period of RA In later years, the OR of 0.31 points to inversion into a significant protective effect Our data contrast with those of other investigations reporting the lack of...

Ngày tải lên: 09/08/2014, 01:23

9 358 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... (b,c,e,g) Expression of c19orf10 in OA synovium (a) Intense staining of the synovial lining layer and perivascular regions of RA (OCT section) tissue.(b) Intense staining of the synovial lining layer ... completely devoid of c19orf10 staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic ... cells in the aggregates stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining layer...

Ngày tải lên: 09/08/2014, 10:20

9 490 0
báo cáo khoa học: "Design and characterization of protein-quercetin bioactive nanoparticles" doc

báo cáo khoa học: "Design and characterization of protein-quercetin bioactive nanoparticles" doc

... School of Chemical Engingeering and Technology, Tianjin University, Tianjin, China), Engr Ke Zhu (Institute of Physics, Chinese Academy of Sciences, Beijing, China), and Dr Yanhong Liu (Technical Institute ... Nutritional Engineering, China Agricultural University, Key Laboratory of Functional Dairy Science of Beijing and the Ministry of Education, Beijing Higher Institution Engineering Research Center of Animal ... The adsorption of Q on proteins was mainly hydrophobic, particularly occurring in the region of Trp residues BSA exhibited the highest binding capacity of Q, indicating that H-bonding and MWs also...

Ngày tải lên: 11/08/2014, 00:23

14 290 0
Design and characterization of functional novel oligopeptides

Design and characterization of functional novel oligopeptides

... fibroin protein is approximately mm but a single silkworm can spin fibroins into silk materials over km in length, two billion times longer [17-18]! Such engineering skills can only make us envy of ... millions of years Half of these biogenic minerals contain calcium; for example, the teeth of the sea urchin contain calcium carbonate (CaCO3) in the form of calcite (the most common polymorph existing ... of three distinct sets of operations: (1) chain assembly of peptide chain on a resin; (2) simultaneous or sequential cleavage and deprotection of the resin-bound, fully protected peptide chain;...

Ngày tải lên: 04/10/2015, 10:25

95 274 0
Design and characterization of interposers for high speed fine pitch wafer level packaged device testing

Design and characterization of interposers for high speed fine pitch wafer level packaged device testing

... pad damage to a minimum Packaging costs are increasing with the complexity of IC’s In addition, the high cost of packaging is necessitating AC testing at wafer level In order to minimize these costs, ... probing aluminum pads, the scrubbing action involved in obtaining penetration of the oxide creates the buildup of aluminum on the probe needle This necessitates cleaning Most cleaning processes ... most of the parts of the proposed interposers can be modeled as transmission lines Knowledge of electrical properties of transmission lines is thus of critical importance in dealing with signal integrity...

Ngày tải lên: 04/10/2015, 10:25

126 203 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... demonstrating monomerization of the recombinant protein Binding of ligands assessed by the intrinsic tryptophan fluorescence The recombinant protein appeared therefore quite amenable to ligand-binding ... regulation of behavioral sequence including feeding of the larvae, capping of the cells and thermoregulation of the brood area in the colony The recombinant protein ASP3c is produced in sufficient ... suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand binding activity of ASP3c was further investigated using displacement of ASA,...

Ngày tải lên: 21/02/2014, 03:20

11 642 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

... role in the cisplatin response [9] Cisplatin interferes with DNA function by causing intrastrand and interstrand crosslinking of nucleotide bases and, in replicating cells, DNA damage usually induces ... tagged proteins (Fig 3C, top panel) HA3–Pph3p interacted with increasing amounts of cH2AX generated in the presence of increasing doses of MMS (Fig 3C) and even with the low levels of cH2AX that ... Psy2p and Psy4p in response to the DNA-crosslinking agent cisplatin and the noncrosslinking, alkylating agent MMS, and show that recovery after cisplatin-induced DNA damage is delayed in pph3D, psy4D...

Ngày tải lên: 30/03/2014, 04:20

11 362 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

... no in the NCBI protein database proteins Filamentous proteins listed in Table 1, i.e lamin B1, lamin A, lamin C, vimentin, keratin types and and actin, were all included in this group Lamins ... elucidate the function of this novel protein in compartments in the interchromatin space, analyses of its dynamics using GFP– ISP36 and searches for binding proteins both in vivo and in vitro are necessary ... immunostaining of ISP36 in Fig Within the nucleus, the protein again seemed to be localized to compartments in the interchromatin space (Fig 7) To further confirm the localization of ISP36, an inter4329...

Ngày tải lên: 30/03/2014, 20:20

12 400 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

... aftermath of integration of medical universities into the ministry of health Therefore, it will be interesting to study the impact of integration on knowledge transfer in the future Competing interests ... Publicaation of articles in domestic journals Publication of articles in international journals Presenting research results in conferences, seminars, and domestic meetings Presenting research results in ... Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison...

Ngày tải lên: 11/08/2014, 05:21

8 341 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

... aftermath of integration of medical universities into the ministry of health Therefore, it will be interesting to study the impact of integration on knowledge transfer in the future Competing interests ... Publicaation of articles in domestic journals Publication of articles in international journals Presenting research results in conferences, seminars, and domestic meetings Presenting research results in ... Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison...

Ngày tải lên: 11/08/2014, 16:21

8 315 0
Magnetic resonance spectroscopy correlation with histological analysis in gliomas and structure determination of a hypothetical protein

Magnetic resonance spectroscopy correlation with histological analysis in gliomas and structure determination of a hypothetical protein

... metabolites in sample NNI1 were assigned There are isoleucine, valine, leucine, alanine, lactate, lysine, acetate, glutamate/glutamine, creatine, choline, tyrosine, threonine and γ-aminobutyric acid in ... contains tyrosine while NNI2 does not Tyrosine is an essential neutral amino acid and a precursor of the neurotransmitters epinephrine, nor-epinephrine and dopamine The presence of tyrosine in ... tumor tissue differ from those of normal brain Spectral changes often shown in brain tumors are the increase in choline, decrease in or absence of NAA and the presence of lactate or lipids Recent...

Ngày tải lên: 10/11/2015, 11:35

92 284 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

... reduction of protein disulfides on insulin as substrate; when the interchain disulfide bridges are reduced between chains A and B of the insulin, the turbidity of the solution increases because of precipitation ... Creighton, T.E., Rowling, P.J & Freedman, R.B (1992) Folding in vitro of bovine pancreatic trypsin inhibitor in the presence of proteins of the endoplasmic reticulum Proteins 14, 10–15 43 Robb, ... activity The action of PfPDO in catalysing interchange of intramolecular disulfides in scrambled RNase results in restoration of the native disulfide pairing and the concomitant return of RNase activity...

Ngày tải lên: 16/03/2014, 16:20

12 506 0
w