... for parents to support the learning of languages other than English through a play based approach Contact the Playgroup Association for further information Maintaining the ... Association, Richmond, Victoria, Australia Nyakatawa, S and Siraj-Blatchford, I 1994, ‘Bilingualism, biculturalism and learning in Early Years Classrooms’, in Blackledge, A (Ed), Teaching bilingual ... important to ascertain how much language they are using at home If necessary use a bilingual worker to talk with the family and establish what language the child speaks at home, ask the family...
Ngày tải lên: 24/02/2014, 18:20
... Hospital, Faisalabad, Pakistan; Saadia Hameed of the Department of Pathology, Madina Teaching Hospital and University Medical College Faisalabad, Pakistan; and Rana Qaiser Mehmood of the Department ... for their contribution in managing the patient, diagnosis and preparation of this case report: Zulifqar Ali, Irshad Ahmad and Zikria Rasheed of the Department of Surgery, Madina Teaching Hospital, ... http://jmedicalcasereports.com/jmedicalcasereports/article/view/8994 migrated into the bladder and was retained in the urinary bladder wall for years, as no such case has been reported in the literature It is thought that injury...
Ngày tải lên: 11/08/2014, 14:20
Báo cáo khoa học: "Crown architecture in relation to productivity of Populus clones in the Pacific Northwest, U.S.A." ppt
... branches was lower in the hybrid clones when compared to the parental species, early and late in the growing season (Fig However, in the middle of the growing season, the ratio was highest in the hybrid ... terminal and the remainder of the stem were determined, as well as DW and leaf area (LA) of leaves of current terminal, proleptic and sylleptic branches Leaf areas of large, representative samples ... of the total LA of the tree, until the end of the growing season These clonal differences in leaf area distribution and leaf area density help explain the substantial differences in light interception...
Ngày tải lên: 09/08/2014, 02:21
Tài liệu PRINCIPLES AND PRACTICES OF ORGANIC LETTUCE SEED PRODUCTION IN THE PACIFIC NORTHWEST potx
... from the coastal valleys of California In the Pacific Northwest, lettuce seed has historically been produced in southwestern Idaho, in the Columbia Basin of Washington, and in Malheur County in ... seed The plants are harvested with the roots in order to Sclerotinia overwinters in the soil as sclerotia, which germinate when soil temperatures increase in the growing season The disease progresses ... plants, but “breaths” and allows incidental rain to pass through, rather than puddle as it will with a tarp The plants should be left to dry until the leaves are crisp In the event of a forecast...
Ngày tải lên: 21/02/2014, 21:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were ... (Fermentas, St.-Leon, Germany; Amersham, Hillerød, Denmark), treatment with T4 DNA ligase (Fermentas) and shrimp alkaline phosphatase (Fermentas) were carried out as prescribed by the manufacturers...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc
... conformational change induced by cGMP binding is thought to induce the release of the autoinhibitory domain from the active site, thereby activating the kinase This is indicated by a remarkable increase ... masses could be measured with an accuracy of a few Daltons, as depicted in Table For all three proteins, the expected theoretical masses matched to the measured masses, assuming, as described previously ... (conformational stability in absence of denaturant) was then calculated [3H]-cGMP binding assay To assay the capability of PKG wild-type to bind cGMP at different urea concentrations, the protein...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... pond area in the province. As shown in Fig. 2, the total area of brackish water shrimp culture has increased approximately 4 times, from 251 ha in 2000 to 902.5 ha in 2007. According ... Tri’s brackish water shrimp culture, the study considers those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. ... noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical modelling) can be used in combination with MCA to arrive at the ʺbestʺ solution(s) in the ...
Ngày tải lên: 22/03/2014, 12:20
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... Altogether, these findings indicate that Jak3 and STAT 5a/ b signals are required to maintain normal numbers of Treg cells in peripheral lymphoid organs and maintain self-tolerance downstream of ... polymorphisms in the IL2RA gene are associated with age at diagnosis in late-onset Finnish type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama ... T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type diabetes in the Japanese population...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo lâm nghiệp: "old hardiness as a factor for assessing the potential distribution of the Japanese pine sawyer Monochamus alternatus (Coleoptera: Cerambycidae) in China" pdf
... determining the geographical range of the beetle Meteorological data showed that local minimum temperature generally decreased with increasing latitude in eastern China (Climatic Atlas of the People’s ... 1st–31st January 2004 Figure The potential distribution and dispersal areas of Monochamus alternatus in China Based on –10 and –4 ◦ C isotherms of January mean air temperature (Climatological Atlas ... overwintering larvae The SCP has proved to be a reliable index to estimate the cold hardiness of the beetle M alternatus The mean SCP of the overwintering larvae was −15.7 ± 0.5 ◦ C with a minimum value...
Ngày tải lên: 07/08/2014, 16:20
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative group when cyclin E was stratified as negative and positive (low/high) Many ... infiltrating duct carcinomas The results of the study conducted by Sasano et al (21 invasive duct carcinomas and 19 invasive lobular carcinomas) showed that there was no significant difference in the...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt
... statistical analysis and the clinical associations AS participated in the analysis and interpretation of data and in the revision of the manuscript RR participated in the design of the study and in the ... actin-based structures such as the contractile ring and stress fibers [22,23] The septins are a family of cytoskeletal GTPases that play an essential role in cytokinesis in yeast and mammalian ... recombinant Nedd5 C-ter appeared confined to the cytoplasm, where staining of the contractile ring was evident No staining was R900 Arthritis Research & Therapy Vol No Margutti et al Figure We analyzed...
Ngày tải lên: 09/08/2014, 06:23
báo cáo khoa học: "Necrotizing sialometaplasia as a cause of a nonulcerated nodule in the hard palate: a case report" pot
... with stabbing pain in the absence of clinical alterations of the mucosa These findings are important for the clinician, who must be aware that a swelling in the palate may not be an inflammatory ... case, the biopsy was obtained at an early stage of the disease, a fact that may explain the absence of an ulcer Squamous metaplasia of the ductal epithelium, accompanied by pseudoepitheliomatous ... sialometaplasia of the palate in a cocaine-using patient A case report Minerva Stomatol 2008, 57:199-202 Imbery TA, Edwards PA: Necrotising sialometaplasia: literature review and case reports JADA 1996,...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot
... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... days after his last check in 2003, approximately three weeks after therapy simplification (Figure 1) Neither a preNNRTI GRT assay was available at that time, nor samples of plasma drawn in advance ... reinforcing at the same time the need for a systematic evaluation of GRT in naïve patients and after any type of interruption of NNRTI-based HAART regimens, as well as the need for a wise strategy...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx
... Tendolkar AG, Magotra RA, Parulkar GB: Temporary intravascular shunts for peripheral vascular trauma J Postgrad Med 1992, 38(2):68-69 Sriussadaporn S, Pak-art R: Temporary intravascular shunt in complex ... limb ischaemia [4,5,9] Pseudoaneurysm formation of the axillary artery is rare following blunt and penetrating trauma to the shoulder, often presenting late as a pulsatile mass rather than acute ... reduction and internal fixation, endovascular treatment was not an option in this patient Following proximal and distal arterial control and thrombectomy, the limb was revascularised temporarily using...
Ngày tải lên: 11/08/2014, 21:22
DETERMINATION OF THE APPROPRIATE CONTENT OF CALCIUM NITRITE AS A CORROSION INHIBITOR IN REINFORCED CONCRETE docx
... extract containing (CN and 6,0 kg Cl-) Research results Effectiveness of corrosion inhibition in extract of cement water containing Cl-: • In H0 extract, steel is maintained in passive state and ... very fast under the effect of chloride ion in marine environment Cua Cam port The strongly agressivity rate of chloride ion is the main reason causing corrosion, especially in the tropical climate ... corroded • The extract containing Cl-: corrosion rate is continuously increased with the time and with Clratios • At [Cl-]/[NO2-] 2,2; corrosion rate was very small Research results Case of reinforced...
Ngày tải lên: 13/08/2014, 22:21
A survey on the attitude of teachers and students toward the integration of some cultural elements in the textbook New English file - elementary in speaking les
... speaking skill, cultural knowledge in the teaching and the learning of speaking skill, in particular; the cultural obstacles to the current teaching and learning of speaking skill in the classroom ... programs and teaching materials in one way or another Many educators have applied these programs into real classroom activities and teaching materials This has been done, also, with the aim of bringing ... culture in language teaching To emphasize the importance of culture in learning and teaching foreign languages Eli Hinkel (1999) has said, “Applied linguists and language teachers have become increasingly...
Ngày tải lên: 28/03/2015, 08:55
An Analysis of Cultural Factors in the Textbook English 12 from the Perspective of English as an International Language = Phân tích các yếu tố văn hóa trong sác
... Communicative Language Teaching EFL English as a Foreign Language EIL English as an International Language ELF English as a Lingua Franca ELT English Language Teaching ESL English as a Second Language FLT ... serves as a basis for them to become intercultural capable and develops cultural awareness if their motivation is to participate in a growing global community 39 Finally, as exams and tests have backwash ... countries in the region or Asia According to the Radio Free Asia (RFA-28/2/2005) investment from Singapore, Taiwan, Korea, Japan into Vietnam accounted for 75% (Vo, 2009) In 2013, Japan and Taiwan are...
Ngày tải lên: 28/03/2015, 09:22
The case for rentierism as a cause forunderdevelopment in malaysia tourism planning from mahathir to the present day
... Malaysiakini’s involvement as follows Eight years ago, the few of us as Malaysiakini set about doing an unenviable task Along the way, we gave Tun Dr Mahathir Mohamad a pain in the neck We gave ... doubts The All Malaya Council of Joint Action (AMCJA), a coalition of the non-Malay opposition parties was formed and later joined the Malay Nationalist Party to form the PUTERA-AMCJA The PUTERA-AMCJA ... coming of age.’80 The Mahathir Years Baker describes Mahathir as having been 'in tune with the younger ascendant capitalist Malays and being 'in the vanguard of a group that was fiercely critical...
Ngày tải lên: 26/09/2015, 12:48
a study on teachers and students attitudes towards the cultural content in the international commercial textbook for non english majors at haiphong private university
... the people whose mother tongue is the language being taught and learnt, the teaching and learning of English as an international language is complicated .As an international language, English no ... of the problem and rationale for the study Culture has been long recognized an inseparable part in teaching language in general and teaching EFL in particular Kramsch (1998) claims that “Language ... change about their teaching cultures, theysaid no changes were possible The main reason of this opinion was the lack of time for teaching in the class, especially with the new learning and teaching...
Ngày tải lên: 25/12/2015, 17:18