mean and why is it a problem

Tài liệu The Decline in the U.S. Personal Saving Rate: Is It Real and Is It a Puzzle? pptx

Ngày tải lên : 16/02/2014, 11:20

... without any limits and this would raise the standard of living both in the United States and abroad Of course, in reality, international capital markets are segmented and far from frictionless, and ... revised Besides these general limitations of the standard BEA and NIPA saving rate measures, a number of statistical and measurement issues have been debated in the literature on the U.S saving ... personal saving rate.8 NIPA Measures of the Personal Saving Rate and (Realized) Capital Gains Distortions are likely to be caused because NIPA conventions exclude (realized and unrealized) capital...

24
500
0

Báo cáo y học: " What is MRI bone oedema in rheumatoid arthritis and why does it matte" ppt

Ngày tải lên : 09/08/2014, 08:23

... hands remain normal Arthritis Rheum 2004, 50:2094-2102 21 Tamai M, Kawakami A, Takao S, Uetani M, Arima K, Tanaka F, Fujikawa K, Aramaki T, Iwanaga N, Izumi Y, et al.: Bone marrow oedema determined ... rheumatoid arthritis reveals bone oedema at the bases of the 2nd and 3rd metacarpals and adjacent regions of trapezoid and capitate carpal bones Small intraosseous erosions are also apparent the influence ... with ankylosing spondylitis Arthritis Res Ther 2006, 8:R143 Barrie HJ: Histologic changes in rheumatoid disease of the metacarpal and metatarsal heads as seen in surgical material J Rheumatol...

5
440
0

cáo khoa học: " Why is it difficult to implement e-health initiatives? A qualitative study" ppsx

Ngày tải lên : 10/08/2014, 10:23

... a decreasing pool of referrals C and B became a central part of this hospital’s business plan to maintain inward referrals and hence overall financial viability: ‘So I wanted to make it so easy ... Doctors, radiologists, radiography administrative staff Community nurses district nurses in an urban area in Scotland The CNIS consisted of hand-held wireless enabled Personal Digital Assistant devices ... clinic and visit scheduling and access to clinical algorithms Professionals affected by technology Primary care: GPs, administrative staff Secondary care: Consultants, outpatient administrative staff...

11
243
0

Is reporting on interventions a weak link in understanding how and why they work? A preliminary exploration using community heart health exemplars docx

Ngày tải lên : 11/08/2014, 05:21

... (personnel award from the Heart and Stroke Foundation of Canada and the Canadian Institutes of Health Research), Dr Kothari (Career Scientist Award from the Ontario Ministry of Health and Long Term Care) ... implementation models that allow for contextual adaptation and feedback processes, and mixed methods designs that guide the integrative analysis of quantitative and qualitative findings These all bring into ... interventions framework and co-developed the propositions with BR All authors contributed substantively to the operational definitions, data extraction, and writing All authors have read and approved...

12
198
0

Trade and Poverty Is There a Connection

Ngày tải lên : 06/11/2012, 15:51

... unskilled labour They provide quality maize meal products to nearby customers in the poor communities in areas such as Mashonaland Central, Manicaland, Masvingo, and Matebeleland North and South, saving ... pp.419-447 Harrison, A and Hanson, G H (1999) ‘Trade liberalization and wage inequality in Mexico' Industrial and Labor Relations Review, vol.52 pp.271-288 Harrison, A and Revenga, A (1998) ‘Labor markets, ... has alternatives to purchasing a good whose price has risen, it can mitigate the cost of a price rise Similarly, if it is able to switch towards an activity that has become more profitable, it...

26
544
0

Loans, Interest Rates and Guarantees: Is There a Link? pdf

Ngày tải lên : 29/03/2014, 01:20

... that lenders ask for guarantees when borrowers are more risky and, thus, interest rates are higher Data and summary statistics This paper uses aggregated and individual Italian bank and firm data ... guarantees are guarantees granted by third parties in favor of borrowers Data are drawn from Statistical Return Loans and Bad Loans Data are drawn from Statistical Return Average Loan Life This ... between bank interest rates and guarantees Our analysis refers to the Italian credit market and uses aggregated and individual statistics drawn from the ESCB (European System of Central Banks) harmonized...

27
398
0

My idea: is it a business? pptx

Ngày tải lên : 29/03/2014, 18:20

... will have to share the profits and lose some control over how your idea is sold The British Franchise Association may be able to help (www.british-franchise.org) Building a team is important, and ... together on research projects All LINK projects must involve at least one company and one research-based organisation Large and small UK companies and even multinational companies can take part (www.ost.gov.uk/link/) ... rates, VAT, and other business taxes, reliefs and allowances • Assess risks and your responsibilities for health, safety, security and the environment • Insure your business and its assets and get...

24
315
0

Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

Ngày tải lên : 09/08/2014, 10:23

... 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3' T7 5'-TAATACGACTCACTATAG-3'...

8
576
0

Báo cáo y học: " The L76V mutation in HIV-1 protease is potentially associated with hypersusceptibility to protease inhibitors Atazanavir and Saquinavir: is there a clinical advantage" potx

Ngày tải lên : 10/08/2014, 05:22

... genotypic resistance interpretation and manuscript revision HW realized the phenotypic resistance analysis PB and AT assissted in concept and design aspects and directed sample- and data acquisition ... Goffard JC, Lazzarin A, Wohrmann A, Katlama C, Wilkin T, Haubrich R, Cohen C, Farthing C, Jayaweera D, Markowitz M, Ruane P, Spinosa-Guzman S, Lefebvre E: Efficacy and safety of darunavir-ritonavir ... L76V-positive patients with ATV and/ or SQV containing therapy was noticeable associated with an additional establishment of the protease gene mutation at position L90 M which resulted in resistance against...

9
434
0

Bóa cáo y học: " Early apoptosis of blood monocytes in the septic host: is it a mechanism of protection in the event of septic shock" ppt

Ngày tải lên : 12/08/2014, 23:23

... Jr, Amado VM, Caserta R, Dalla Valle Martino M, Pasternak J, et al.: Ventilator associated pneumonia: comparison between quantitative and qualitative cultures of tracheal aspirates Crit Care ... pointed towards a predominance of Gram-negative bacteria as responsible pathogens and towards a monomicrobial cause of VAP (Table 1) It was proved that apoptosis is a phenomenon taking place in blood ... constitute a separate pathophysiological mechanism in sepsis, it should probably be correlated to survival For that purpose, the survival of each group was estimated by Kaplan-Meyer analysis; comparisons...

8
350
0

Báo cáo y học: " Impact factor, H index, peer comparisons, and Retrovirology: is it time to individualize citation metrics?" ppsx

Ngày tải lên : 13/08/2014, 05:22

... USA China USA USA France France France Italy France USA USA Japan Japan USA USA Japan USA Canada France USA Denmark USA UAE USA UK USA Australia USA UK UK Canada Ireland USA France Germany USA ... journal's IF is a poor surrogate indicator of individual articles published in that journal There is a statistical pattern to citations that on average 15% of the articles in a journal accounts ... Cambridge University McGill University Niigata University Ohio State University Bethesda Montpellier Amsterdam Cambridge Montreal Niigata Columbus USA France the Netherlands UK Canada Japan USA 39 15...

4
236
0

Gamma glutamyltransferase is it a biomarker of oxidative stress

Ngày tải lên : 06/10/2015, 21:29

... Parkinson's disease, liver disease, sickle cell anemia, HIV, AIDS, cancer, heart attack, stroke, and diabetes47 Patients with glutathione reductase deficiency exhibit cataract and premature aging ... MTS assay manual) The absorbance of formazan was measured at 490nm This assay measures the dehydrogenase enzyme activity found in metabolically active cells and procedures of this assay were carried ... proportionate increase in GGT than in aspartate transaminase (AST) or alanine aminotransferase (ALT) as shown in figure 1.10.3.1 below 26 Figure 1.10.3.1 The graph was taken from Nagaya et al.139 and...

110
396
0

Tài liệu Is It the Network? Solving VoIP Problems on a Wireless LAN ppt

Ngày tải lên : 24/01/2014, 09:20

... each G.711 call In addition to understanding basic bandwidth requirements, one must also understand three important problems that may affect call quality: delay, jitter, and packet loss Delay ... unacceptable levels When handling the effect that handset roaming has on wireless VoIP, it s best to be familiar with both the network and the handset Make sure that APs are at a good distance to handle ... that each AP can handle 100 calls at a time Unfortunately, excessive delay and jitter would cause the network to be rendered unusable if an AP had 100 VoIP handsets calling at once A typical...

11
478
0

What is a Mouse-Trap Car and How does it Work? pdf

Ngày tải lên : 16/03/2014, 12:20

... This means that your car must building your mouse-trap car that there are situations in which you would want to increase the air resistance A good example is the use of a parachute on a dragster ... they can move faster Trucks have a special cowling that increases their aerodynamics and allows air to flow more easily over the trailer Increased aerodynamics saves energy Fish have aerodynamic ... car that travels faster, farther and wastes less energy The most common area where surface friction will occur is between the axle and the chassis The interface between the axle and the chassis...

15
699
3

báo cáo khoa học: "Why don’t hospital staff activate the rapid response system (RRS)? How frequently is it needed and can the process be improved?" potx

Ngày tải lên : 10/08/2014, 10:23

... DeVita MA, Braithwaite RS, Mahidhara R, Stuart S, Foraida M, Simmons RL: Use of the medical emergency team responses to reduce hospital cardiopulmonary arrests Quality and Safety in Healthcare ... Resuscitation 1998, 37:133-137 Tortolani AJ, Risucci DA, Rosati RJ, Dixon R: In-hospital cardiopulmonary resuscitation: patient and resuscitation factors associated with survival Resuscitation ... call behaviour amongst staff For example, the attitude of the MET call team on their arrival may have a substantial effect on the culture of the clinical area If the team is negative and critical,...

7
436
0

báo cáo khoa học: ""For someone who''''s rich, it''''s not a problem". Insights from Tanzania on diabetes health-seeking and medical pluralism among Dar es Salaam''''s urban poor" ppsx

Ngày tải lên : 11/08/2014, 14:21

... treatment and therefore stays at home and thus lacks adequate care Although biomedical treatment for diabetes in Tanzania is over-subscribed and often inadequate, it is more organised than in many ... specialist diabetes training Specialist diabetes care was only available at five referral hospitals, run by a small number of consultant diabetes physicians and diabetes educators and hence access ... doctor at a private diabetes clinic he attended Hasani had migrated to Dar es Salaam when he was 16 and had lived for many Page of years with an uncle who had recently passed away due to diabetes It...

9
394
0

Báo cáo y học: " Non-operative management of blunt abdominal trauma. Is it safe and feasible in a district general hospital?" doc

Ngày tải lên : 13/08/2014, 23:20

... design, analysis and interpretation of data; drafting the manuscript IEK was involved conception and design, acquisition, analysis and interpretation of data; performed statistical analysis; revision ... remaining mechanisms Trauma severity was evaluated according to Injury Severity Score (ISS) and organ injury according to Injury Scaling and Scoring System [9] Patients' status in admission was ... was not a cut-off hematocrit value and therefore transfusion was rather empirical However, older patients (>70 years old) and patients with coronary disease were transfused when hematocrit was...

6
435
0

Why customer service is failing and why its time to turn it upside down

Ngày tải lên : 16/02/2016, 18:38

... delayed, frustrated and ignored on our twisted route to resolution The bad news is that expectations are rising fast Some innovators have seized market share quite visibly on the back of fantastic ... waste Great customer companies tend to have great customer communities that weigh in and help each other out Because happy customers are the best and smartest advocates That’s what an upside ... nice way to say this: Customer service, on average, ranges from disappointing to The ‘good’ news is that expectations are really, really low When an issue comes up, we all expect to be thwarted,...

30
419
0