... What is the present situation of teaching and learning English listening skills in grade 10 at YMBHS? What are the difficulties in teaching and learning English listening skills in grade 10 at ... findings This study aims to investigate the real situation of teaching and learning English listening skills in grade 10 at YMBHS, Ninh Binh province Based on the 36 findings and analysis in the ... teaching and learning English listening skills in grade 10 at YMBHS? What are the difficulties in teaching and learning English listening skills in grade 10 at YMBHS as perceived by the teachers and...
Ngày tải lên: 30/03/2015, 14:28
... students was to investigate: - the current situation of learning English listening skills in grade 10 at YMBHS; - the students’ difficulties in learning English listening skills; and - their suggested ... English listening skills in grade 10 at YMBHS, Ninh Binh province Based on the findings and analysis in the previous parts, this discussion focuses on answering the three questions proposed in the methodology ... in language teaching and learning at school 3.1.2 The teachers’ and students’ opinions about the students’ listening competence 3.1.3 The teachers’ and the students’ opinions about the listening...
Ngày tải lên: 04/08/2015, 09:41
Applying the tasked based language teaching in teaching pronunciation at high school
Ngày tải lên: 28/08/2014, 09:32
Applying communicative language teaching in teaching grammar at Long Xuyen high school
Ngày tải lên: 24/11/2014, 00:05
Tài liệu Eating well for older people: Practical and nutritional guidelines for food in residential and nursing homes and for community meals doc
... foods, eating plenty of vegetables and fruits and choosing foods low in salt and fat In addition, maintaining a healthy body weight, drinking alcohol in moderation and ensuring foods are stored and ... evidence at that time and made recommendations on how older people can maintain adequate nutritional status While new data Food and eating bring shape to a day and facilitate social interaction, ... combined to create a rapidly growing care industry of residential care accommodation – including both residential homes and nursing homes – and an increased demand for care in people’s own homes...
Ngày tải lên: 13/02/2014, 18:20
The memory book the classic guide to improving your memory at work, at school, and at play
... Think of earring, and it will remind you of bucket What silly thing was the bucket doing? Singing, of course -and that reminds you of sing What else was singing? A basketball Thinking of basketball ... "memorization." We believe that there are three basic learning skills: 1) the search for information, 2) remembering the information, and 3) applying the information The search is up to the educators ... Washington, wash; West Virginia, best virgin; Wisconsin, wise eousin; Wyoming, roamiog If you've gone down the list of states ten at a time, using the combination of Substitute Words and Linking,...
Ngày tải lên: 08/03/2014, 18:24
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt
... nervous system patterning In addition, the constitutive expression of CXCL14 in adult carp and mouse brain indicates a role in normal brain physiology These functions in patterning and maintenance ... GAGGAGGACCACCATGCATCT TTGTGCAAGCAGTCCAGAAAGA GGATGCAGGCAATACTCCTG CCATACTGCCAAGAAAAGATGAT ACAGAGGCATACAAGTGCAGATG TGTTTAGGCTTGATCTCCAGCTT CTGGGATTCCTGACCATTGGT GTTGGCTCTCTGTTTCAATGCA GGGCAGGTGTTTTTGTGTTGA ... monocyte-activating chemokine (BMAC), a novel non-ELR alpha-chemokine Int Immunol 12, 677–689 11 Klein, R.S & Rubin, J.B (2004) Immune and nervous system CXCL12 and CXCR4: parallel roles in patterning and...
Ngày tải lên: 16/03/2014, 18:20
Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx
... education program for school nurses National Education Association Health Information Network www.asthmaandschools.org, 800-718-8387 Information on asthma for teachers and administrators National ... partners in the planning and decision making involved in the child’s welfare Both IDEA and “504” outline student evaluation procedures and stipulate the creation of individual health plans—an Individualized ... asthma at Parks Middle School in Atlanta ticipate fully in school activities and potentially become a top athlete Jackie Joyner-Kersee and Greg Louganis have asthma, and at least one in six athletes...
Ngày tải lên: 23/03/2014, 23:20
HOW TO SUCCEED IN SCHOOL AND UNIVERSITY - A GUIDE FOR PARENTS AND STUDENTS pot
... they are: Linguistic intelligence, logical-mathematical intelligence, musical intelligence, bodily-kinesthetic intelligence, spatial intelligence, interpersonal intelligence - understanding other ... societies this translates into the IQ fallacy that intelligence is innate and that nothing can be done to change a person’s IQ Individual IQ can be boosted and learning enhanced in many ways Do not ... scale mathematical operations Most of the statistical analyses I are multivariate and involve the inversion of matrices I remember being told by a professor that graduate students were employed in...
Ngày tải lên: 03/07/2014, 04:20
Báo cáo y học: "Bullying in school and cyberspace: Associations with depressive symptoms in Swiss and Australian adolescents" docx
... M, Finkelhor D: The relative importance of online victimization in understanding depression, delinquency, and substance use Child Maltreatment 2007, 12:314 Hinduja S, Patchin JW: Cyberbullying: ... for nonindependence of the data resulting from the clustered sampling, which can lead to inflated Type I error rates, through the inclusion of a random intercept in the models Clustering in the ... longitudinal studies has demonstrated that peer victimisation and exclusion may also increase children’s depressive symptoms [10-13] These findings indicate that peer rejection and victimisation...
Ngày tải lên: 13/08/2014, 18:21
a study on historical and social background and the newness of language use in pride and prejudice by jane austen = nghiên cứu cơ sở lịch sử, xã hội và tính mới của việc sử dụng ngôn ngữ trong tác phẩm
... being much more intelligent than others in analyzing and evaluating others‟ opinions and status through her own points of view Another morning she was at home alone writing to Jane back home in ... expressing to the woman he loved The feelings he could not press any more The pain started in vain and would finish in vain Without knowing what he would get back, overcoming his inner struggle in ... a home- tutor, had a great desire in reading books while Darcy exposed his reading interest in preserving his father‟s big library in the house, revealed during Elizabeth‟s stay in Pemberley and...
Ngày tải lên: 02/03/2015, 14:19
Difference between in hand and at hand
... They have four babies and six dogs on their hands Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org...
Ngày tải lên: 11/07/2015, 13:26
A study on historical and social background and the newness of language use in ‘Pride and Prejudice’ by Jane Austen
... descriptive and contextual methods of data collecting and analyzing Basing on the huge resources of library and internet materials, the researcher analyzed and then agglutinated those ideas into her ... (1826) once stated in his commentary All the certain circumstances were just within the leading involvement of one family and their neighbours and friends in which Austen created “some heroines who ... novel at first and became overexcited about the novel since she finished reading it for the first time The novel was really linked to both of the real world and the emotional changes inside individuals,...
Ngày tải lên: 10/08/2015, 19:47
Difference between in hand and at hand
... They have four babies and six dogs on their hands Stay on top of your writing! Download our grammar guide from www.englishgrammar.org to stay up-to-date Powered by TCPDF (www.tcpdf.org)...
Ngày tải lên: 29/08/2016, 18:03
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school
... concept include a group’s way of thinking, feeling, and acting, and fixed patterns for doing certain things According to Thompson (1990:132), “the pattern meaning embodied in symbolic forms, including ... factors involved in speaking 1.3 Cultural factors in the teaching and learning of speaking skills in classrooms 1.3.1 What cultural factors influence on the teaching and the learning of speaking skills ... teach a language without teaching a culture It means that teaching language is teaching culture Therefore, teaching culture has been integrated into language teaching programs and teaching materials...
Ngày tải lên: 07/09/2013, 13:00
a study on the problems in teaching english speaking skills to the minority students at sonla ethnic boarding high school and so
... rhythm, intonation patterns Fluency Good transactional and interpersonal skills Skills in talking short and long speaking in turns Skills in the management of interactions Skills in negotiating ... that conversation can be analyzed in terms of routines, which are conventional ways of presenting information In Bygates opinion, there are two kinds of routines They are information routines and ... 1.2 .Language skills It is understood that language communication involves several language skills On the teaching points of views, language skills consist mainly of four- macro skills ( listening, speaking,...
Ngày tải lên: 07/09/2013, 13:06
TEACHING READING ESP IN INTEGRATION WITH THE OTHER LANGUAGE SKILLS TO STUDENTS OF LINGUSTICS AT UNIVERSITY OF SOCIAL SCIENCES AND HUMANITIES, VIETNAM NATIONAL UNIVERSITY, HANOI
... reading in ESP teaching and learning; − Chapter II introduces the advantages of skill-integration in teaching and learning reading and relationship between this skill and the other language skills ... of a reading lesson They are carried out in the light of Communicative Language Teaching with a hope that there will be some improvement in teaching and learning reading skills in integration with ... 2.3 Relationship between reading skills and other language skills …… 2.3.1 Reading and listening …………………………………………… 2.3.2 Reading and speaking ………………………………………… 2.3.3 Reading and writing ……………………………………………...
Ngày tải lên: 07/09/2013, 13:45
A Study on the Problems in Teaching English Listening Skills to the 10th form Students at Phu Ly B High School and some Suggested Solutions
... situation of teaching and learning ELS at this school? 2.4 Data collection instruments In order to obtain in- depth, rich data and information for investigating the situation and the problems that ... reading skills rather than on other skills such as speaking, listening and writing Also, the main purpose of teaching and learning English at the school is for the final exams This certainly ... teaching and learning listening skills at PB school 2 Aims and objectives of the study Within the framework of a minor thesis, the study is aimed at: - Clarifying the practices of teaching and...
Ngày tải lên: 19/03/2015, 10:34