materials required for soil conservation
AMINIMUM NUMBER OF PHYSICAL EDUCATION CREDITS SHOULD BE REQUIRED FOR GRADUATION OF COLLEGE
Ngày tải lên :
02/08/2013, 01:27
...
requires at least one competitor to fail for each competitor that wins.
Thanks to it, we can learn to share, to be self sacrificed,to work
together with others for common goal. These are the reasons ... like
swimming, gymnastic teaches students how to work independently to
reach an aim; helps reinforce his self-confidence, self-reliance. Team
sports like football, basketball…helps develop social ... should be part of the graduation requirements of any
university or college; they are of high value for a student’s health,
character-training and his betterment. , .{468 words)
...
2
961
0
Tài liệu effective internet presenceted demopoulos’now required for success in business and life doc
Ngày tải lên :
14/02/2014, 04:20
... information about Ted is available via Google, or:
Internet Business Strategy: www.EffectiveInternetPresence.com
Information Security: www.demop.com
Effective Internet Presence: Now required for ... Presence: Now required for success in business and life
Ted Demopoulos
7
This Personal Branding Thing
A brand is what prevents something from being a commodity. It’s why I pay more for a
cup of ... inappropriate for you.
Your personal brand, which includes what people find when they look you up online,
needs to be authentic. It has to be the real you.
Effective Internet Presence: Now required for...
40
452
0
Tài liệu Readability and Patient Education Materials Used for Low-Income Populations pptx
Ngày tải lên :
14/02/2014, 14:20
... consideration. See the answer/enrollment form after the article for additional information
regarding the program.
Readability and Patient
Education Materials Used for
Low-Income Populations
MEG WILSON, ... method was used
for this study. Providers were asked to submit written
PEMs used most frequently for their clients. Inclusion
criteria were that materials were in English and written
format. Patient ... Because of the composi-
tion of formulas, they can be used only for text and not for
tables, charts, or word lists. These tools provide a reading
grade level needed for the material but do not assess...
8
418
0
Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc
Ngày tải lên :
18/02/2014, 06:20
... involved in siroheme and cobalamin bio-
synthesis. Therefore, it was proposed that the NirE
protein could be the SUMT required for heme d
1
formation [22]. However, so far, this has not been
demonstrated ... of
871.2687 for the [M-H]
)
ion, which corresponds to the chemical
formula C
43
H
44
N
4
O
16
, in accordance with the mass and chemical
formula of trimethylpyrrocorphin in its trilactone form.
S. ... Europe (Carnforth, UK).
Plasmids, bacteria and growth conditions
The E. coli strain DH10B was used as the host for cloning,
and E. coli BL21(DE3) was used as the host for protein
production. For complementation...
10
539
0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
Ngày tải lên :
19/02/2014, 16:20
... sequence contains
positive regulatory element(s) required for basal Prm3
activity.
Bioinformatic analysis of Prm3, using the mat-
inspector
TM
program [26], for transcription factor ele-
ments between ... dialysis, nuclear debris was pelleted at 16 000 g for
10 min and the protein concentration of nuclear extracts
were determined using the Bradford assay [57]. For elec-
trophoretic mobility supershift ... motif for tonic internalization. J Biol
Chem 276, 7079–7085.
22 Walsh MT, Foley JF & Kinsella BT (2000) The alpha,
but not the beta, isoform of the human thromboxane
A2 receptor is a target for...
18
509
0
Tài liệu Báo cáo khoa học: Nop53p, an essential nucleolar protein that interacts with Nop17p and Nip7p, is required for pre-rRNA processing in Saccharomyces cerevisiae pdf
Ngày tải lên :
20/02/2014, 01:20
... Zanchin for suggestions and critical reading of this
manuscript; Sandro R. Valentini for anti-GST serum;
Tereza C. Lima Silva and Zildene G. Correa for DNA
Table 3. DNA oligonucleotides used for ... cerevisiae Nip7p is
required for efficient 60S ribosome subunit biogenesis.
Mol Cell Biol 17, 5001–5015.
10 Zanchin NIT & Goldfarb DS (1999) The exosome
subunit Rrp43p is required for the efficient ... and are required for ribosome bio-
genesis. Mol Cell Biol 17 , 7088–7098.
20 Lafontaine DLJ & Tollervey D (1999) Nop58p is a
common component of the box C+D snoRNPs that is
required for snoRNA...
14
505
0
Tài liệu Báo cáo Y học: Phosphorylation of initiation factor-2a is required for activation of internal translation initiation during cell differentiation ppt
Ngày tải lên :
22/02/2014, 07:20
... The membrane was then used for Western analysis
using antibodies specific for Ser51-phosphorylated eIF2a
(Research Genetics, Inc.), and following stripping mAb
specific for total eIF2a were used.
Polysome ... nitrocellulose membrane which was then used
for Western analysis using polyclonal antibodies specific for
Vav (Santa Cruz) and polyclonal antibodies specific for
CKIIa (a gift from D. Canaani, Tel Aviv ... eIF2a was
detected using antibodies specific for phosphorylated Ser51. The same
membrane was stripped and used for Western analysis using antibodies
specific for total eIF2a.TheeIF2a-P/eIF2a ratio in...
10
409
0
Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot
Ngày tải lên :
07/03/2014, 00:20
... complexes required for
transcription. Mol Cell 11, 1301–1309.
49 Sudarsanam P, Cao Y, Wu L, Laurent BC & Winston
F (1999) The nucleosome remodeling complex, Snf ⁄ Swi,
is required for the maintenance ... critical for normal galactose induction of the
tested genes. Interestingly, the strains lacking either the
Fig. 3. The activator-binding domains of the SWI ⁄ SNF complex are
required for its recruitment ... corepressor complex are
differentially important for the repression of different
target genes in fission yeast [45,46].
Swi1 and Snf5 are known to be required for the
structural integrity of the SWI ⁄...
9
539
0
Báo cáo khoa học: Definition of the residues required for the interaction between glycine-extended gastrin and transferrin in vitro pptx
Ngày tải lên :
07/03/2014, 02:20
... cooperativity between the lobes is
required for iron release [7,8]. Transferrin adopts a
‘closed’ (holo) conformation when iron enters the cleft,
and an ‘open’ (apo) conformation when iron is
released. ... is still unknown. Knowledge of the regions of
transferrin required for the binding of gastrin, and of
the regions in gastrin required for the interaction with
transferrin, is obviously essential ... lobe were required for the
interaction with Ggly. The affinity of Ggly for each
of the two authentic monoferric transferrins was simi-
lar and only slightly weaker than the affinity for
recombinant...
9
543
0
Báo cáo khoa học: YidC is required for the assembly of the MscL homopentameric pore potx
Ngày tải lên :
07/03/2014, 02:20
... remained
unexplored. Given recent evidence that, for certain
IMPs, YidC is not only required for membrane inser-
tion of individual subunits, but also for assembly of
those subunits in higher-order ... very
scarce. Using mutants compromised for SRP, Sec or
YidC functioning, we found that the SRP is required
for optimal targeting of MscL but the Sec translocon
is not needed for insertion, consistent with ... non-depleted IMVs. This
indicates that YidC is required for assembly of the
MscL complex (Fig. 5).
To investigate the role of the Sec translocon in for-
mation of the MscL–HA complex, SecE-depleted
IMVs...
9
466
0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
Ngày tải lên :
07/03/2014, 05:20
... protein.
Lpx1p is not required for peroxisome biogenesis
Having shown that Lpx1p is targeted to peroxisomes
by the soluble PTS1 receptor, we wished to determine
whether Lpx1p is required for the biogenesis ... speculate that Lpx1p is required
for a multidrug resistance response that did not show
a phenotype in our experiments. We could, however,
exclude epoxide hydrolase activity for Lpx1p, because
hydrolysis ... Saccharomyces cerevisiae. EF-1b is
essential for growth. FEBS Lett 316, 165–169.
24 McDonald HB & Byers B (1997) A proteasome cap
subunit required for spindle pole body duplication in
yeast....
11
568
0
Báo cáo khoa học: Caspase-8- and JNK-dependent AP-1 activation is required for Fas ligand-induced IL-8 production ppt
Ngày tải lên :
07/03/2014, 09:20
... inhibitor for JNK but not for MAPK ⁄ ERK
kinase inhibited the FasL-induced AP-1 activation and IL-8 production.
These results demonstrate that FasL-induced AP-1 activation is required for
optimal ... (2006) NF-kappaB is required for UV-induced
JNK activation via induction of PKCdelta. Mol Cell 21,
467–480.
40 Itoh N & Nagata S (1993) A novel protein domain
required for apoptosis. Mutational ... indicate that the catalytic activity of ca-
spase-8 is required for FasL-induced AP-1 activation.
The JNK signaling pathway is required for
FasL-induced AP-1 activation and IL-8 production
FasL...
9
362
0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
Ngày tải lên :
07/03/2014, 15:20
... sequence at the N-terminus of the protein was also
shown to be required for the activity and/or secretion of the
GCPII carboxypeptidase. As for the N-terminally modified
variants, the absence of the ... lumen, providing
space and time for the unfolded/partially folded proteins to
acquire the correct 3D conformation. The proteins that fail
to attain their native conformation are subsequently degra-
ded ... indispensable for the
enzymatic activity of GCPII.
Acknowledgements
The authors wish to thank Jana Starkova
´
and Tat’a
´
na Mra
´
zkova
´
for
excellent technical assistance. This work (performed under...
9
414
0
Báo cáo khoa học: Saccharomyces cerevisiae Ybr004c and its human homologue are required for addition of the second mannose during glycosylphosphatidylinositol precursor assembly ppt
Ngày tải lên :
07/03/2014, 16:20
... [1,2]. Synthesis
of GPIs is essential for cell wall formation and viabil-
ity of yeast cells [3–5], for embryonic development in
mammalian cells [6], and for viability of the parasites
Leishmania ... metabolic
labeling was performed with 20 lCi [
14
C]ethanolamine for
23 h at 25 °C. For radiolabeling of double mutant strains,
cells were grown in SGlyYE medium for 2 days at 25 °C,
then grown ... biochemical function has been described
for any Ybr004c protein, although its Drosophila homo-
logue (termed ‘vegetable’) was identified in a screen
for genes implicated in formation of the peripheral ner-
vous...
9
398
0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
Ngày tải lên :
08/03/2014, 10:20
... [8–10,12,32], the xMGP promoter was
analyzed for the presence of response elements for the
vitamin D
3
and retinoic acid receptor. However, no regu-
latory elements for steroid hormone receptors or growth
factors ... January 2002, accepted 20
February 2002)
GGAAAC-3¢) for amplification of the region from )783 to
+33, and (5¢-CC G
GAGCTCGAGGGAGATGAGGAG
GTGTGG-3¢) for amplification of the r egion f rom )54 to
+33, ... oligonucleotides (5¢-GA
AGATCTACCACACCTCCTCATCTCC-3¢) for ampli-
fication of the region from )180 to )36 and (5¢-GA
AGAT
CTAACTAGATTTTACCATTGG-3¢) for amplification
of the region from )180 to )72, respectively....
10
475
0
Xem thêm