master+cable+to+work+with+a+remote+modem
focal press - building websites with html5 to work with mobile phones (2011)
... ability to send data back to a � database The ability to store data locally in your web browser is dramatically improved with the implementation of LocalStorage LocalStorage is essentially the ability ... geographically based tools � Local Data Storage Key to applications is the ability to store data In the past you have been able to this by using complex cookies or Ajax � commands that leverage the ability ... var host = location.hostname; var myLocalStorage = globalStorage[host]; The second function allows you to store data using the LocalStorage API: function writeLocal() { var data = $('text').value;...
Ngày tải lên: 21/03/2014, 11:54
Dangerous liaisons how businesses are learning to work with their new stakeholders
... companies adopt a strategic approach to stakeholder management in the new media Andrew Kakabadse, professor of international management development at Cranfield School of Management, suggests that ... Similarly, in financial services, “ten years ago, our engagement would only have been to refute something or create a discussion,” says Gavin Laws, head of corporate affairs at Standard Chartered ... contributing to the extinction of endangered orangutans Some activist organisations, while working with large multinationals on some initiatives, continue to campaign against those same companies for what...
Ngày tải lên: 04/12/2015, 00:04
A simple introduction to working with LVM
... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... might be useful to take a look at them with the pvdisplay command: root@lappy:~# pvdisplay - Physical volume PV Name /dev/hda3 VG Name skx-vol PV Size 28.88 GB / not usable Allocatable yes PE Size...
Ngày tải lên: 18/09/2012, 10:12
What To Do If Trapped In A Lift With A Dentist
... charge 10 THINGS YOU WOULDN'T WANT FOR CHRISTMAS A dead robin in a sock, a relaxation CD that appears to be voiced by Ian Paisley A pair of trainers pickled in bree A vague sense of inadequacy ... of the place Sellotape a photo of Hitler onto a beer mat and then smear his face with a gallon of pig fat Pretend you're using a laptop by folding some cardboard in half and writing a windows ... others history is a corpse leave it alone it teaches us nothing except how to repeat past mistakes again and again and again WAR War what is it good for? Reinvigorating depressed economies and winning...
Ngày tải lên: 14/11/2012, 16:50
Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP
... conventional parameter apparatus such as temperature, pH and conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, ... the anaerobic (total length: 51m), anoxic (total length: 85.9m) and aerobic (total length: 331.1m) tanks after simple pretreatment without primary sedimentation tank The reversed anaerobic and anoxic ... which means to adjust the parameters and calibrate the model to adapt the practical process The WWTP software should be setup according to the process of real plant according to the abstracted...
Ngày tải lên: 05/09/2013, 09:08
A STUDY ON TECHNIQUES TO DEAL WITH NON EQUIVALENCE IN TRANSLATING ENGLISH IDIOMS INTO VIETNAMESE
... content and language are acceptable and understandable to the readership Idioms Idiom as special forms of language carry a large amount of culture information, such as history, geography, religion, ... idioms, known as semantically decomposable idioms, can be paraphrased in a way that assigns a meaning to individual words, even if some of them are non-standard, as examples: - leads a dogs life ... the data are analyzed and some examples are illustrated to help the learners understand deeply about the tips to deal with the non-equivalence in translating English idioms into Vietnamese Aims...
Ngày tải lên: 11/12/2013, 23:53
Tài liệu Work with Data-Bound Multi-Select List Boxes Using Windows Forms It is common to have to assign docx
... frmHowTo8_1.vb: Loading Categories into the List Box Private Sub frmHowTo8_1_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles MyBase.Load Dim odaCategories As OleDb.OleDbDataAdapter ... called odaCategories and loading the category's SQL Statement into it The dtCategories data table is then filled and set as the DataSource property of cboCategories The DisplayMember and ValueMember ... dtCategories As New data table() ' Load the Categories combo box up first odaCategories = New _ OleDb.OleDbDataAdapter( _ "Select CategoryID, CategoryName From Categories", (BuildCnnStr("(local)",...
Ngày tải lên: 14/12/2013, 20:16
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
... Sundays, many families have a traditional meat at home: grilled meat with potatoes, vegetables and gravy For many English people, dinner is a main meal and the whole family often have dinner together ... by an amount of water or steam in a confined space For example: They kept up a good head of steam 16 (in place names) a headland For example: Beach head 17 A main division in a lecture, an essay, ... Similarly, when we say not beat a dead horse we not refer to a carcass of a certain kind of animal but what we mean is that a person should not waste time thinking of an issue that has already...
Ngày tải lên: 20/12/2013, 18:33
Tài liệu Updating a DataSet with a Many-to-Many Relationship ppt
... changes made to the DataSet with the data source Refresh Button.Click This event handler clears all data from the DataSet LoadData( ) is then called to load all data from the data source into ... each The LoadData( ) method is called to retrieve data for each table in the DataSet Finally, the default view for the parent and the child tables are bound to data grids on the form LoadData( ... SqlDbType.NVarChar, 50, FIELD3_FIELD); updateCommand.Parameters.Add(FIELD4_PARM, SqlDbType.NVarChar, 50, FIELD4_FIELD); daChild.UpdateCommand = updateCommand; // Create the ParentChild DataAdapter daParentChild...
Ngày tải lên: 26/01/2014, 10:20
It’s Not You, It’s Your Strategy: The HIAPy Guide to Finding Work in a Tough Job Market
... that, “more than five million Americans who are 44 to 70 are already engaged in a stage of work after their first careers that has a social impact, mainly in education, health care, www.hillaryrettig.com / page 17 ... more about that Whereas in Part I, I wrote a lot about your reasonable fears as a job applicant, now let’s talk about the hirer’s reasonable fear of making a bad hire, which can be a catastrophic ... chapters partly because it’s a lot of work to write a free book, and so I need to stop at a reasonable place, and also partly because that kind of information is already available from many other sources...
Ngày tải lên: 09/02/2014, 20:53
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... from amino acid sequence data Anal Biochem 182, 319–326 Liu Q, Kasuga M, Sakuma Y, Abe H, Setsuko M, Yamaguchi-Shinozaki K & Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an ... poly.[d (A- T)].poly[dAdT] (Amersham Pharmacia Biotech) gradient of 0.001– 10 lg was added to a final volume of 10 lL of each aliquot After incubation for a further 10 min, the contents were loaded on to an 8%...
Ngày tải lên: 18/02/2014, 13:20
Breast cancer risk in relation to occupations with exposure to carcinogens and endocrine disruptors: a Canadian case–control study pptx
... (nonauto) Plastics manufacturing (auto) 26 Metal-related Metallurgical, metalworking, metal fabrication 64 75 Transportation Transportation 37 26 Cleaning/beauty care Beauty salon/hair care 25 ... large retail sector as reference (data not shown) That sector appeared to have less than average breast cancer risk (Tables 1, 3) and, as a result, all the estimates for other sectors increased considerably ... Luginaah I, Laukkanen E, Hellyer D, Reinhartz A, Watterson A, Abu-Zahra H, Maticka-Tyndale E, Schneider K, Beck M, Gilbertson M: Occupation and breast cancer: a Canadian case– control study Ann...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
... mode An external calibration was performed using standard peptide solution Cal Mix1 and Cal Mix2 (Applied Biosystems) and an additional internal calibration was performed during mass spectra analysis ... build an inclusion list with the light and heavy precursor masses for cross-linked candidate peptides analysis NanoLC-LTQ-Orbitrap data were processed automatically as described as well as manually ... et al an accurate mass and time tag approach Mass Spectrom Rev 25, 450–482 Supporting information The following supplementary material is available: Fig S1 Analytical strategy for Ure2p–Ssa1p...
Ngày tải lên: 15/03/2014, 00:20
Social Perspectives in Mental Health Developing Social Models to Understand and Work with Mental Distress potx
... face a wide range of barriers to their full social and economic participation that are to with stigma, discrimination and prejudice Discriminatory social attitudes and practices may be seen to ... from a trauma may (or may not) lead individuals towards manifestations of mental distress that are conventionally given a range of medical diagnostic labels from anorexia to psychosis (Brown, Harris ... may not seem to be a problem To claim it as one may appear partisan, trivialising and unhelpful It is not intended to be so But critics may argue that to deny the individual has a ‘mental health...
Ngày tải lên: 15/03/2014, 01:20
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... PCR (mutated nucleotides are in bold): 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢ (Trp551 fi Ala), 5¢-GTTGCTGTTAGCCTGAACCCAC GAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAA CCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTGTTA...
Ngày tải lên: 16/03/2014, 12:20
Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx
... real world value Thus, a null value is practically a declaration of the unsoundness of a particular data value The Closed World Assumption states that a database contains all the data that it attempts ... SYSTEM THAT ANNOTATES ITS ANSWERS 63 In addition, Panorama extends the query language with three statements to manipulate and query the meta-database To add a new property view to the meta-database, ... information in the database may suggest additional characterizations of the extensional answer If this intensional information is extracted, database values may gain additional meaning Thus, a database...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx
... forms as the training/evaluation data The evaluation metrics used in the abbreviation generation are exact-match accuracy (hereinafter accuracy), including top-1 accuracy, top-2 accuracy, and top-3 ... problem, as compared to the generation problem Eytan Adar 2004 SaRAD: A simple and robust abbreviation dictionary Bioinformatics, 20(4):527– 533 Hiroko Ao and Toshihisa Takagi 2005 ALICE: An algorithm ... (2003), SaRAD (Adar, 2004), ALICE (Ao and Takagi, 2005), Chang and Sch¨ tze’s u method (CS) (Chang and Sch¨ tze, 2006), Nadeau u and Turney’s method (NT) (Nadeau and Turney, 2005), and Okazaki et al.’s...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: "A New String-to-Dependency Machine Translation Algorithm with a Target Dependency Language Model" pot
... the cat(Da red apple ) = LA(cat(Da ), LA(cat(Dred ), cat(Dapple ))) (b) Figure 6: Operations over well-formed structures = LA(LC(cat(Da ), cat(Dred )), cat(Dapple )) vantage of various translation ... Schwartz, L Micciulla, and J Makhoul 2006 A study of translation edit rate with targeted human annotation In Proceedings of Association for Machine Translation in the Americas W Wang, K Knight, and ... Michigan, June J Eisner and G Satta 1999 Efficient parsing for bilexical context-free grammars and head automaton grammars In Proceedings of the 37th Annual Meeting of the Association for Computational...
Ngày tải lên: 17/03/2014, 02:20
Learn To Build With PHP: A Crash Course
... is dizzyingly large It is the database behind WordPress and Facebook, and is based upon the reliable relational database paradigm Advantages of the MySQL database are too numerous to mention Firstly, ... Variables Variables are a concept found in virtually all programming languages They are used to store a value, which can be retrieved, used and changed later on You might be familiar with a ... where variables are declared with the ‘var’ keyword var x = 10; In PHP, however, variables are declared with a dollar symbol $x = 10; PHP variables cannot start with a number or a special character...
Ngày tải lên: 19/03/2014, 11:46