marine natural products as a source for drug discovery

Marine Chemical Ecology - Chapter 16 potx

Marine Chemical Ecology - Chapter 16 potx

Ngày tải lên : 12/08/2014, 00:21
... from natural sources including semisynthetic derivatives, synthetic analogs, as well as the original natural products. 6 A major advantage in using natural products as a source for drug discovery ... identification of additional drug leads CH3 N S O N N N HN CH3 N N H CH3 16.18 N H 16.19 III MARINE NATURAL PRODUCTS AS A SOURCE FOR DRUG DISCOVERY A HISTORICAL ASPECTS The use of marine natural products ... molecular basis of these disease areas, additional targets will become available A number of compounds listed in Table 16.1 have not proved suitable as drug candidates but are being used as molecular...
  • 21
  • 226
  • 0
Báo cáo hóa học: " A survey of classical methods and new trends in pansharpening of multispectral images" docx

Báo cáo hóa học: " A survey of classical methods and new trends in pansharpening of multispectral images" docx

Ngày tải lên : 20/06/2014, 22:20
... based on Wavelet and Figure Laplacian pyramid created from Gaussian pyramid by subtraction Amro et al EURASIP Journal on Advances in Signal Processing 2011, 2011:79 http://asp.eurasipjournals.com/content/2011/1/79 ... a multiscale transform and a local directional transform First, a multiscale LP that detects Amro et al EURASIP Journal on Advances in Signal Processing 2011, 2011:79 http://asp.eurasipjournals.com/content/2011/1/79 ... spatial quality of the pansharpened images Besides visual analysis, there is a need to quantitatively assess the quality of different pansharpened images Quantitative assessment is not easy as...
  • 22
  • 772
  • 0
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

Ngày tải lên : 30/03/2014, 15:20
... TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG ... AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ATCAACTACTTTGTGAG TCCATGATATGATTGATATGC GTGGCAATGGTAATCCAC Site-directed ... mutagenesis GCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG GGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC GTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC CATATGTAGATGGAGCTGGAACTGTCCCTG GGAGTGTCACTTAATGCACCCTTTGATGTTTG...
  • 13
  • 448
  • 0
báo cáo hóa học:" Reinterpretation of evidence advanced for neo-oogenesis in mammals, in terms of a finite oocyte reserve" pdf

báo cáo hóa học:" Reinterpretation of evidence advanced for neo-oogenesis in mammals, in terms of a finite oocyte reserve" pdf

Ngày tải lên : 20/06/2014, 07:20
... lineage, and endothelial and vascular smooth muscle progenitors; and the para-aortic splanchnopleura, for lymphoid Notarianni Journal of Ovarian Research 2011, 4:1 http://www.ovarianresearch.com/content/4/1/1 ... In summary, the data of Johnson et al [7] on BU treatment of female mice causing aplasia and ovarian failure are interpretable entirely by cytotoxicity to early and late stage oocytes, and disruption ... assumptions and providing alternative explanations (summarised in Table 1) for observations advanced - Page of 20 and maintained - as key by advocates of the hypothesis, adding to the considerable body...
  • 20
  • 407
  • 0
Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

Ngày tải lên : 20/06/2014, 23:20
... the transmission probability τ s as a function of the chemical potential displays a near symmetrical Breit-Wigner peak centered at the bonding molecular state and an asymmetrical Fano line shape ... molecular junction can be realized by using a twodimensional electron gas below the surface of an AlGaAs/GaAs heterostructure [1] The RSOI in the QD can be introduced by using an asymmetrical-interface ... Spin-polarized current and spin accumulation in a three-terminal two quantum dots ring Appl Phys Lett 2008, 92:172104-172106 41 Uchida K, Takahashi S, Harii K, Ieda J, Koshibae W, Ando K, Maekawa S,...
  • 10
  • 351
  • 0
Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt

Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt

Ngày tải lên : 22/06/2014, 18:20
... (1999) 15 A Vasanelli, R Ferriera, G Bastard, Phys Rev Lett 89, 216804 (2002) 16 M.T Todaro, A Salhi, L Fortunato, R Cingolani, A Passaseo, M De Vittorio, P Della Casa, F Ghiglieno, L Bianco, IEEE ... state of InAs QDs capped with an InGaAs quantum well We have found that the higher energy states of the QDs don’t act as intermediate stages in the carrier relaxation, while the carriers can ... Hopkinson, R .A Hogg, D.J Robbins, D.J Mowbray, M.S Skolnick, IEEE Photonics Technol Lett 17, 1139 (2005) A Salhi, L Martiradonna, G Visimberga, V Tasco, L Fortunato, M.T Todaro, R Cingolani, A Passaseo,...
  • 3
  • 290
  • 0
Báo cáo hóa học: " Research Article Challenges and Trends in Analyses of Electric Power Quality Measurement Data" doc

Báo cáo hóa học: " Research Article Challenges and Trends in Analyses of Electric Power Quality Measurement Data" doc

Ngày tải lên : 22/06/2014, 23:20
... increase the value of power quality monitoring as proposed in [4] There are two streams of power quality data analysis, that is, offline and online analyses The offline power quality data analysis, as ... as a function of system characteristics (resonance conditions) and load characteristics Transient analysis which includes statistical analysis of maximum voltage, transient durations, and transient ... of data as they are captured The analysis results are available immediately for rapid dissemination Complexity in software design requirement for online assessment is usually higher than that...
  • 5
  • 250
  • 0
Báo cáo lâm nghiệp: "Processes of loss, recruitment, and increment in stands of a primeval character in selected areas of the Pieniny National Park (southern Poland" ppt

Báo cáo lâm nghiệp: "Processes of loss, recruitment, and increment in stands of a primeval character in selected areas of the Pieniny National Park (southern Poland" ppt

Ngày tải lên : 07/08/2014, 03:22
... broadleaves Abies alba 456 12 102 93 147 410 Abies alba Fagus sylvatica and other broadleaves Abies alba Fagus sylvatica and other broadleaves Acer pseudoplatanus 75 85 Acer pseudoplatanus 60 Fagus ... Walusiówka Stand layer acc to IUFRO classification 22 15 Fagus sylvatica and other broadleaves 72 Other 44 76 128 Abies alba Fagus sylvatica Other Abies alba Fagus sylvatica 57 45 Fagus sylvatica and ... Babia Góra Mt National Park Journal of Forest Science, 47: 60–74 JAWORSKI A. , PALUCH J., 2002 Factors affecting the basal area increment of the primeval forests in the Babia Góra 287 National...
  • 12
  • 362
  • 0
Báo cáo lâm nghiệp: "Radial distribution of sap flux density in trunks of a mature beech stand" pot

Báo cáo lâm nghiệp: "Radial distribution of sap flux density in trunks of a mature beech stand" pot

Ngày tải lên : 07/08/2014, 16:21
... probably intercepting enough light or had an aboveaverage leaf area/basal area ratio Vincke et al [27] found that Radial sap flow in beech trunks SFD variability was larger in a thinned than in an ... 10 classes with similar cumulated basal area (Abas ), but different numbers of trees We selected one representative tree with median basal area in each class for xylem sap flux measurements (Tab ... sectional area ratio was to Our model of radial xylem sap flux density profiles was devised on the basis of data from representative trees of all basal area classes Even if it is only reliable a depth...
  • 8
  • 276
  • 0
Báo cáo y học: "Cyclophosphamide in systemic sclerosis: still in search of a ‘real life’ scenario" potx

Báo cáo y học: "Cyclophosphamide in systemic sclerosis: still in search of a ‘real life’ scenario" potx

Ngày tải lên : 09/08/2014, 01:22
... the authors performed a sensitive analysis that also considered a treatment initiation after 0.7 and years from the diagnosis, they demonstrated that an early initiation of the treatment was associated ... 1.5 years) and 0.44 QALYs if started after years from the diagnosis [9] These data clearly demonstrate that an early diagnosis of ILD in SSc is fundamental for starting a treatment that may ameliorate ... was associated with a greater preservation of lung function and that it allowed a gain of 0.20 qualityadjusted life years (QALYs) versus a loss of 0.21 QALYs of the case base (disease duration of...
  • 3
  • 301
  • 0
báo cáo khoa học: "Kaposiform hemangioendothelioma in tonsil of a child associated with cervical lymphangioma: a rare case report" pptx

báo cáo khoa học: "Kaposiform hemangioendothelioma in tonsil of a child associated with cervical lymphangioma: a rare case report" pptx

Ngày tải lên : 09/08/2014, 01:24
... out a myofibromatosis that has been documented at this site and in similar aged patients [7] Infact, the present case was initially reported as myofibromatosis at another laboratory Variable SMA ... hemangioma [11] A similar coexistence of lymphangiectasia with vascular tumor nodules is seen in a tufted angioma KHE and tufted angioma are probably same part of the spectrum Cases of an acquired ... informed consent was obtained from the patient for publication of this case report and any accompanying images Author details Department of Pathology, Tata Memorial Hospital, Parel, Mumbai Department...
  • 8
  • 471
  • 0
Báo cáo khoa học: " Partial direct contact transmission in ferrets of a mallard H7N3 influenza virus with typical avian-like receptor specificity/" potx

Báo cáo khoa học: " Partial direct contact transmission in ferrets of a mallard H7N3 influenza virus with typical avian-like receptor specificity/" potx

Ngày tải lên : 12/08/2014, 04:21
... 100 %a 100%b A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/34/2001(H7N1) A/ mallard/Alberta/79/2003(H2N3) ... influenza viruses in a ferret contact model J Virol 2007, 81:6890-6898 Chandrasekaran A, Srinivasan A, Raman R, Viswanathan K, Raguram S, Tumpey TM, Sasisekharan V, Sasisekharan R: Glycan topology ... (Qiagen, Valencia, CA, USA) in accordance with manufacturer's instructions Reverse transcription was carried out with the uni12 primer (5'AGCAAAAGCAAGG-3') and AMV reverse transcriptase (Promega, Madison,...
  • 12
  • 267
  • 0
Báo cáo y học: " Detection of epithelial to mesenchymal transition in airways of a bleomycin induced pulmonary fibrosis model derived from an α-smooth muscle actin-Cre transgenic mouse" potx

Báo cáo y học: " Detection of epithelial to mesenchymal transition in airways of a bleomycin induced pulmonary fibrosis model derived from an α-smooth muscle actin-Cre transgenic mouse" potx

Ngày tải lên : 12/08/2014, 16:20
... primers: forward 5'GAAGATCTATGCCCAAGAAGAAGAGGAAGGTGTCCAATTTACTGAC-3' and reverse 5'-CGGAATTCTGAACAAACGACCCAAC-3' The PCR product was then sub-cloned into the BamHI-EcoRI site of the VSMP8 plasmid (a ... myofibroblasts and the process resulting in devastating airway aggravation Previously, it was suggested that peribronchiolar and perivascular fibroblasts transdifferentiate into myofibroblasts following ... was purchased from Santa Cruz Biotechnology (Cat sc-7870), rabbit anti-mouse/human E-cadherin pAb was purchased from Boster Company (Cat BA0475) GAPDH mAb was purchased from Chemicon (Cat CB1001)...
  • 11
  • 433
  • 0
Báo cáo y học: "Acute kidney injury in the intensive care unit: current trends in incidence and outcome" potx

Báo cáo y học: "Acute kidney injury in the intensive care unit: current trends in incidence and outcome" potx

Ngày tải lên : 13/08/2014, 08:20
... [3] Another potential explanation is the availability of less nephrotoxic alternatives for various drugs and contrast agents This may also be related to a reduction in the use of old therapy mainstays ... ANZICS Database Management Committee: Changes in the incidence and outcome for early acute injury in a cohort of Australian intensive care units Crit Care 2007, 11:R68 Ympa YP, Sakr Y, Reinhart ... creatinine and urine output Emerging biomarkers of AKI, such as neutrophil gelatinase-associated lipocalcin and cystatin C, give us a view of the biological clock, and the use of commercially available...
  • 2
  • 338
  • 0
Báo cáo y học: "Trends in transfusion of trauma victims evaluation of changes in clinical practice" pdf

Báo cáo y học: "Trends in transfusion of trauma victims evaluation of changes in clinical practice" pdf

Ngày tải lên : 13/08/2014, 23:20
... including extraction and analysis of data was approved as a quality-assessing project The following data were extracted from the hospital based trauma registry; Anatomic injury according to Injury ... prepared ready for transfusion upon arrival of the patient Trauma packages (including plasma) can also be requested before arrival of the patient to reduce delay in balanced transfusion The latter ... of all trauma patients, transfused trauma patients and massively transfused trauma patients day 1-10 after admittance Total units of erythrocytes administered each day to the transfused patients...
  • 9
  • 242
  • 0
Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc

Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc

Ngày tải lên : 17/02/2014, 22:20
... In the past 50 years, annual cost escalation rates for amphibious ships, surface combatants, attack submarines, and nuclear aircraft carriers have ranged from to 11 percent (Table S.1) Although ... that the data for nuclear aircraft carriers span a more limited range of time, from FY 1958 to FY 1995, and nearly all these carriers are for Nimitz-class hulls As a result, the carrier data, ... Table 2.2 summarizes annual growth rates for a select set of components for as many years as available since 1965 (some components, such as college tuition, are not reported as far back as 1965) CPI...
  • 124
  • 583
  • 0
Tài liệu Why Has the Cost of Fixed-Wing Aircraft Risen - A Macroscopic Examination of the Trends in U.S. Military Aircraft Costs over the Past Several Decades pptx

Tài liệu Why Has the Cost of Fixed-Wing Aircraft Risen - A Macroscopic Examination of the Trends in U.S. Military Aircraft Costs over the Past Several Decades pptx

Ngày tải lên : 17/02/2014, 23:20
... the annual buys that the funds are used to purchase HAPCA data included only estimates for fiscal year 2000 We replaced these with actual cost data in our database Data and Price Trends which was ... Navy asked RAND to examine the causes of military aircraft cost escalation From available data, we calculated cost escalation rates as well as their “economy-driven” and “customer-driven” causes ... available databases include Air Force and Navy current and historical factsheets and those of enthusiast associations.7 The P-1 database quantity information for USN matched but the overall cost numbers...
  • 118
  • 543
  • 0
báo cáo hóa học: " Incidence of Raynaud''''s phenomenon in relation to hand-arm vibration exposure among male workers at an engineering plant a cohort study" doc

báo cáo hóa học: " Incidence of Raynaud''''s phenomenon in relation to hand-arm vibration exposure among male workers at an engineering plant a cohort study" doc

Ngày tải lên : 20/06/2014, 00:20
... 148 subjects examined 1986) At baseline and at follow up a questionnaire was answered at the time for a medical examination The baseline and the follow up investigations were all performed during ... for the years 1987–1992 Class was 1601– 3520 h · m/s2, class was 3521–7070 h · m/s2, class was 7071–18086 h · m/s2, and exposure class was >18086 h · m/s2 Exposure assessment The subjective assessments ... nonfatal risks as well as to death but the approach originated from data that related to death [14] "Survival" was defined here as the proportion of the cohort not having RP with time The basic...
  • 6
  • 340
  • 0
Báo cáo hóa học: "Improving global influenza surveillance: trends of A(H5N1) virus in Africa and Asia" doc

Báo cáo hóa học: "Improving global influenza surveillance: trends of A(H5N1) virus in Africa and Asia" doc

Ngày tải lên : 21/06/2014, 19:20
... countries in Asia and Africa and the increase in human cases, demonstrate that influenza A viruses remain a global pandemic threat [1,2] Worldwide, natural migrations of birds and commercialization ... epidemiological data and operational information about disease outbreaks This system manages critical information about outbreaks and accurate and timely communications between international public health ... distribution, and reproduction in any medium, provided the original work is properly cited Magdalena Escorcia,Aff1 Email: magdaescorcia@exalumno.unam.mx Matias S Attene-Ramos,Aff2 Email: matias.atteneramos@nih.gov...
  • 18
  • 444
  • 0