map of a test area in central italy

Economic Evaluation Of A Warehouse Investment In Central Europe Case Study At Nokian Heavy Tyres Ltd.

Economic Evaluation Of A Warehouse Investment In Central Europe Case Study At Nokian Heavy Tyres Ltd.

... room of expansion Tax system and regulations Local investment incentives and tax allowances Quality and variety of transportation carriers, highway access Public warehouse Availability and proximity ... technical, handling The annual amounts of the four categories are defined according to actual salaries practices and the applicable laws in the specific country 25 23 KAPOOR, S.K., KANSAL, P.: Basics ... charged a basic fee for handling and storage Value-added services are typically priced on a negotiated basis 34 When having regard to private warehousing, capital investment related to acquiring...

Ngày tải lên: 12/12/2016, 20:34

59 290 0
Báo cáo y học: "Organic farmers use of wild food plants and fungi in a hilly area in Styria (Austria)." docx

Báo cáo y học: "Organic farmers use of wild food plants and fungi in a hilly area in Styria (Austria)." docx

... by Brassicaceae and Asteraceae (3 species each), then Lamiaceae, Plantaginaceae, Boletaceae, Agaricaceae, Russulaceae and Ramariaceae (2 species each) For 15 families only one species was listed ... widespread uses of gathered greens are for Taraxacum sp leaves as a salad, often mixed with Page 12 of 14 potatoes (Solanum tuberosum) (Röhrlsalat), and the preparation of Urtica dioica as a spinach ... Styria, in Austria The hill country is situated in the east of the provincial capital of Graz and covers an area of 215 km2 In total 29,000 people live there [27] The annual precipitation averages...

Ngày tải lên: 10/08/2014, 09:21

14 414 0
Báo cáo khoa học: " Yellow-necked mice (Apodemus flavicollis) and bank voles (Myodes glareolus) as zoomonitors of environmental contamination at a polluted area in Slovakia" doc

Báo cáo khoa học: " Yellow-necked mice (Apodemus flavicollis) and bank voles (Myodes glareolus) as zoomonitors of environmental contamination at a polluted area in Slovakia" doc

... zoomonitors of environmental contamination at a polluted area in Slovakia Acta Veterinaria Scandinavica 2010 52:58 Page of Submit your next manuscript to BioMed Central and take full advantage of: • ... Cd, lead (Pb), Cu and Zn, and the associated environmental contamination may increase the heavy metal content of mammals inhabiting the polluted areas In general, there is a significant relationship ... steelworks and zinc smelters in Poland Toxicology 2003, 186:1-10 Metcheva R, Teodorova S, Topashka-Ancheva M: A comparative analysis of the heavy metals and toxic elements loading indicated by small mammals...

Ngày tải lên: 12/08/2014, 18:22

5 161 0
Báo cáo y học: "Hypervascular nodule in a fibrotic liver overloaded with iron: identification of a premalignant area with preserved liver architecture" docx

Báo cáo y học: "Hypervascular nodule in a fibrotic liver overloaded with iron: identification of a premalignant area with preserved liver architecture" docx

... used AFP – α-fetoprotein; ALAT – alanine aminotransferase; ASAT – aspartate aminotransferase; BMI – body-mass index; CRBP1 – cellular retinol-binding protein 1; FNH – focal nodular hyperplasia; ... lesions and hepatocellular carcinoma in a non-cirrhotic alcoholic patient with iron overload and normal transferrin saturation J Hepatol 1999, 30:325-329 Attia A, Blanc JF, Saric J, Balabaud C, ... vein and the artery CK7 immunostaining However, this area was considered as premalignant based on the following arguments: arterial hypervascularization with isolated arteries in the parenchyma...

Ngày tải lên: 13/08/2014, 13:20

11 209 0
Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx

Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx

... per dam Sires and dams are assumed to be unrelated Only offspring are measured, with one datum per animal ;j ’ are according to a sample consists of n sire families (i one offspring = Models and ... to the assumed polygenic variation When two alleles A and a are segregating at a major locus, three genotypes are possible (AA, Aa, aa) which we shall respectively denote 1, 2, Sires are of genotype ... genotype and normally distributed with a mean and a variance U u ij E is the residual random effect, assumed to be independent of the genotype t and normally distribued with a mean and a variance...

Ngày tải lên: 14/08/2014, 20:20

17 352 0
ARCHITECTURE OF PUBLIC SERVICE COMPLEX IN CENTRAL URBAN AREA OF HANOI

ARCHITECTURE OF PUBLIC SERVICE COMPLEX IN CENTRAL URBAN AREA OF HANOI

... Trafic planning - zoning - zoning districts - Central planning - residential areas planning - Rest areas planning Diagram 2.6 Planning structure of the expanded inner-city area -13- Basic structures ... expanded inner-city area (a part of central urban area) in Hanoi - Solution group of maintenance and renovation applied for current public service space in current residential areas with deficiency of ... conditions of the expanded inner-city area (a part of central urban area) in Hanoi as follows: -25- Principle 1: Maintain the current public service space, insert new functions in principle of “compressing”,...

Ngày tải lên: 06/11/2014, 16:15

29 357 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... parameters defined in Tables and in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy project located ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attractiveness Table Economic and financial indicators...

Ngày tải lên: 05/09/2013, 14:59

14 416 1
Sensor-based navigation of a mobile robot in an indoor environment

Sensor-based navigation of a mobile robot in an indoor environment

... obtained after including the unknown obstacle in the data base and starting again the planning [15] In fact the main penalization due to unknown obstacles is the decreasing of the linear speed of ... We are interested in the navigation of a mobile robot in partially known environment such as inside an of ce or a flat In such cases, a plan of the evolution zone of the robot containing most of ... the beginning of the learning the robot is near a wall in an unknown Vr = min(Va , Cvg Vmin ), where Vmax and Vmin are the maximum and minimum chosen linear speed, respectively An example of implementation...

Ngày tải lên: 23/10/2013, 15:15

18 432 0
Tài liệu Báo cáo khoa học: Metabolic flux profiling of Escherichia coli mutants in central carbon metabolism using GC-MS docx

Tài liệu Báo cáo khoa học: Metabolic flux profiling of Escherichia coli mutants in central carbon metabolism using GC-MS docx

... expected, as the fractions of pyruvate originating from malate and PEP originating from OAA that are indicative of in vivo malic enzyme and PEP carboxykinase activity, respectively, were already at ... ratios of diverging pathways and the MDV of CO2 according to Eqn (9) A summary of all obtained MDV is given in Table Calculation of metabolic flux ratios The intracellular pool of a given metabolite ... skeletons, and the standard deviation of these redundant data was used for calculation of the covariance matrix Cm of the measured individual mass intensities Standard deviations of the calculated...

Ngày tải lên: 20/02/2014, 23:20

12 422 0
Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc

Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc

... Pa lar Tu vien Poaceae/bamboo Calamus walkeri /rattan Acacia auriculiformis/Acacia Musaceae/banana Wendlandia glabrata/tree Licuala spinosa/Licuala palm Tarrietia javanica/tree Cleistanthus aff ... availability Maltsoglou and Rapsomanikis (2005) reported that livestock plays an important role in household income in rural areas of Vietnam Acacia plantation is a potential source of substantial ... name Firewood Pahy name Basketry Table 13 Most important forest plants by categories of use (all groups) Poaceae Calamus walkeri Acacia auriculiformis Musaceae Wendlandia glabrata Licuala spinosa...

Ngày tải lên: 21/02/2014, 04:20

118 556 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the above interpretation was further reinforced...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

... transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial strains and plasmids ... immunoprecipitated with antiserum directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig 4B, lane 1) In addition, cross-linking adducts of  220 kDa and ... immunoprecipitated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager (B) Quantification of data presented in panel (A) , after correction for translation...

Ngày tải lên: 08/03/2014, 09:20

8 547 0
The Project Gutenberg EBook of A First Book in Algebra, pot

The Project Gutenberg EBook of A First Book in Algebra, pot

... subtracted from − 4a to obtain a? (− 4a) − (− 3a) =? Examine now these results expressed in another form 33 From take 5a 3a 2a To add 5a − 3a 2a From take 4a 7a − 3a To add 4a − 7a − 3a From take 2a 5a ... 2ax2 + ax + 2a 17 A man pumps x gallons of water into a tank each day, and draws off y gallons each day How much water will remain in the tank at the end of five days? 18 Two men are 150 miles apart, ... 2a, 3a, 4a, 5a What must be added to 2a to obtain 5a? What then must be subtracted from 5a to obtain 2a? 5a − 3a =? What must be added to − 3a to obtain 4a? What then must be subtracted from 4a to...

Ngày tải lên: 15/03/2014, 00:20

189 432 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra ... the following oligonucleotide primers: 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast expression ... thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were in ltrated into the same leaves of tobacco plants, which had been sprayed with 100 lm ABA, 400 lm ABA or H2O and kept in...

Ngày tải lên: 15/03/2014, 00:20

15 479 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A 78 A1 K UG a ... UG na B C1 thalia T89 UG 9B1 A UGT8 9A1 P A thaliana M T7 UG 0.1 UGT8 a lian tha C UGT9 2A1 A thaliana A rum rba ba UGT90 A1 A th aliana UGT 73D1 A tha UG liana T 0L na lia A t D 73C 1 3B 3A T7...

Ngày tải lên: 28/03/2014, 23:20

11 661 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada) ... from the National Science and Engineering Research Council of Canada S Seah thanks the Canadian Foundation for Innovation and Ontario Innovation Trust for infrastructure support We thank Valerie ... metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization of the anion...

Ngày tải lên: 30/03/2014, 15:20

9 461 0
báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

... development of the computer program which had to include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... feedback of HRQoL has as of yet not been widely implemented in clinical practice This may be explained by the initial lack of convincing data regarding the effectiveness of standardized HRQoL measurement...

Ngày tải lên: 18/06/2014, 19:20

9 477 0
báo cáo hóa học: " A randomized trial of a lifestyle intervention in obese endometrial cancer survivors: quality of life outcomes and mediators of behavior change" pptx

báo cáo hóa học: " A randomized trial of a lifestyle intervention in obese endometrial cancer survivors: quality of life outcomes and mediators of behavior change" pptx

... demographic and clinical data was obtained at baseline and prior to randomization QOL and self-efficacy were assessed at baseline and at 3, 6, and 12 months Eating behavior and depression was assessed ... measures analysis of variance (ANOVA) with the 3, and 12 month data as outcomes and the appropriate baseline measurement as a covariate to test for the main effect of group (LI versus UC, intention-to-treat ... indicating an increase likelihood to overeat in the presence of disinhibitors This was an unexpected finding and may indicate that there are still certain triggers that are evident and more attention...

Ngày tải lên: 18/06/2014, 19:20

9 444 0
w