management of a design system in a collaborative design environment using pegase
Management of pulmonary tuberculosis patients in an urban setting in Zambia: a patient’s perspective ppt
Ngày tải lên :
06/03/2014, 04:20
... University of Zambia UNZA), and Macro International Inc: Zambia Demographic and Health Survey 2007 Calverton, Maryland, USA; CSO and Macro International Inc; 2009 World Health Organization: “TB ... Ministry of Health, Lusaka, Zambia Central Statistics Office: Summary Report, Zambia 2000 Census of Population and Housing Central Statistics Office, Lusaka, Zambia; 2003 Ministry of Health: Tuberculosis ... modifications incorporated in the final version The collected data was entered in an MS Access database using Epi Info™3.5.1 (Centers for Disease Control and Prevention, Atlanta, GA, USA), with in- built...
- 8
- 612
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
Ngày tải lên :
23/03/2014, 13:20
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... indicate size of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...
- 11
- 475
- 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
Ngày tải lên :
20/06/2014, 00:20
... strain on the bursa subacromialis and so in a typical case of "painful arc" the movement would cause less pain The most reliable test of internal and external rotation is carried out with the arms ... involves asking the patient to place his hands behind his back (in Table 2: Differential diagnosis of lumbar spine disorders Lumbar pain Lumbago Sciatica Radicular syndrome disorders affecting spinal ... Testing for cranial movement of the spinae iliacae posteriTesting for cranial movement of the spinae iliacae posteriores superiores supine This part of the functional diagnostic examination begins...
- 10
- 575
- 0
báo cáo khoa học: "The management of advanced oral cancer in a Jehovah''''s Witness using the Ultracision Harmonic Scalpel" docx
Ngày tải lên :
09/08/2014, 02:21
... a statim dose of gram tranexamic acid and anaestethseia was induced with a combination of propofol (120mg), fentanyl (100mcg) and vecuronium (8mg) Anaesthesia was maintained using a remifentanil ... Previous surgery in JW have used aprotinin, a bovine derived inhibitor of trypsin and plasmin However, this was withdrawn in May 2008 due an increased risk of death in cardiac surgical patients[13] ... Case report: The management of advanced oral cancer in a Jehovah’s Witness using the Ultracision Harmonic Scalpel Peter J Kullar1*, Kristian Sorenson2, Ruwan Weerakkody1 and James Adams1 Department...
- 18
- 463
- 0
Báo cáo khoa học: "Management of gastrointestinal stromal tumours in the Imatinib era: a surgeon''''s perspective" pps
Ngày tải lên :
09/08/2014, 07:21
... unresectable and metastatic GIST; however surgeons are faced with management dilemmas in the following situations • Small GIST Small GISTs are often diagnosed radiologically as an incidental finding ... Cavaliere D, Vagliasindi A, Mura G, Framarini M, Giorgetti G, Solfrini G, Tauceri F, Padovani F, Milandri C, Dubini A, Ridolfi L, Ricci E, Verdecchia GM: Downstaging of a gastric GIST by neoadjuvant ... suggested a prospective evaluation [6,7] Most of the current research is directed towards establishing the role of Imatinib as an adjuvant to surgery [8-11] Management of small GIST is mainly in the...
- 4
- 345
- 0
Báo cáo y học: " Perioperative infusion of low- dose of vasopressin for prevention and management of vasodilatory vasoplegic syndrome in patients undergoing coronary artery bypass grafting-A double-blind" potx
Ngày tải lên :
10/08/2014, 10:20
... for inotropes and their dosage, as well as the mean dose and duration of norepinephrine administration Statistical analysis All data are expressed as mean value ± standard deviation Values in ... vasodilatory hypotension after cardiac transplantation J Heart Lung Transplant 1999, 18:814-817 32 Tayama E, Ueda T, Shojima T, Akasu K, Oda T, Fukunaga S, Akashi H, Aoyagi S: Arginine vasopressin ... vasopressin infusion in advanced vasodilatory shock tends to improve myocardial performance by increasing of intramyocardial calcium concentrations, and producing coronary artery vasodilatation, Papadopoulos...
- 12
- 336
- 0
Báo cáo khoa học: " Management of a rare case of arrhythmogenic right ventricular dysplasia in pregnancy: a case report" pot
Ngày tải lên :
10/08/2014, 23:21
... necrosis and then to inflammation and repair by fibrofatty tissue During pregnancy, plasma volume, cardiac output and heart rate increase, hematocrit decreases and physiologic anemia are established ... Page of Dalal D, James C, Devanagondi R, Tichnell C, Tucker A, Prakasa K, Spevak PJ, Bluemke DA, Abraham T, Russell SD, Calkins H, Judge DP: Penetrance of mutations in plakophilin-2 among families ... our patient while she was under general anesthesia to avoid strenuous labor and the hemodynamic changes of epidural anesthesia Cardiovascular collapse during anesthesia in patients with ARVD has...
- 4
- 232
- 0
Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot
Ngày tải lên :
11/08/2014, 12:20
... hospital’s Pediatric Intermediate Care Unit Pain was managed using Paracetamol and Piritramid intravenously as needed After the surgery, the boy complained of a relapsing upper abdominal pain Laboratory ... (warm touch) General anaesthesia with endotracheal intubation was performed as total intravenous anaesthesia using Propofol and Fentanyl Cisatracurium was used as a muscle relaxant Surgery was ... is a consensus that imbalances in homoeostasis can cause critical exacerbation of SCD For that reason, it is essential to maintain normovolemia, normothermia and normoxemia during anaesthesia and...
- 6
- 438
- 0
Báo cáo y học: "Technetium-99m scan in the laparoscopic management of a misdiagnosed Meckel’s diverticulum: a case report" docx
Ngày tải lên :
11/08/2014, 17:21
... biochemical parameters and urinalysis The patient had a long history of recurrent abdominal pain From the age of 12, he started occasionally having mild abdominal pain located mostly in the right ... Meckel’s diverticulum and intestinal duplication Semin Pediatr Surg 1999, 8:202-208 Okazaki M, Higashihara H, Saida Y, Minami M, Yamasaki S, Sato S, Nagayama H: Angiographic findings of Meckel’s diverticulum: ... for definitive diagnosis and treatment of gastrointestinal bleeding of obscure origin in children J Pediatr Surg 2000, 35:1291-1293 Shalaby RY, Soliman SM, Fawy M, Samaha A: Laparoscopic management...
- 4
- 360
- 0
Báo cáo y học: "Development and management of systemic lupus erythematosus in an HIV-infected man with hepatitis C and B co-infection following interferon therapy: a case report" doc
Ngày tải lên :
11/08/2014, 17:21
... negative A CT scan of the abdomen revealed thickened terminal ileum and moderate ascites Diagnostic paracentesis revealed a Antinuclear antibody (ANA), which had formerly been negative five years ... renal function and proteinuria allowed the successful cessation of haemodialysis on 26 December 2006 In May 2007, a gradual rise in ANA, anti-DNA levels and creatinine were noted necessitating ... HCV-related liver disease with immunosuppressants remains unclear, and his viral load remains high In view of his known liver disease and anaemia, we avoided azathioprine and used mycophenolate and...
- 5
- 624
- 0
Báo cáo y học: "Management of severe crush injury in a front-line tent ICU after 2008 Wenchuan earthquake in China: an experience with 32 cases" pot
Ngày tải lên :
13/08/2014, 19:20
... injury are in a state of hypotension and need intravenous administration of a large volume of fluids, including artificial plasma, 5% glucose, NaHCO3, aescigenin, and human serum albumin Colloid ... front-line ICU for major disasters Advantages of front-line ICU after an earthquake A front-line ICU is very important for treatming crush injury patients after disasters such as an earthquake, because ... had chest trauma, had cerebral trauma, had splenic rupture, had open tibia fracture, had spinal injuries, and had perinephrium and retroperitoneal hematoma The mean entrapment period of the patients...
- 8
- 386
- 0
The states management of new religious movements in singapore a case study of ISKCON
Ngày tải lên :
16/10/2015, 11:57
... the Bhagavad Gita Chaitanya specifically espoused the chanting of the Hare Krishna mantra: Hare Krishna Hare Krishna, Krishna Krishna Hare Hare, Hare Rama Hare Rama, Rama Rama, Hare Hare, as the ... Chaitanya)’ and join Bengali Vaishnavas in the congregational chanting of Krishna’s and Chaitanya’s names (www.indiadivine.org) His son, Bhaktisiddhanta Saraswati Thakur carried on his work by accepting ... zeal in spreading its teachings to foster a better world and the espousal of Sai Baba as a god-man renders the revitalization label while its flexibility in allowing practitioners in maintaining...
- 126
- 858
- 0
Tài liệu Ecology and Management of a Forested Landscape Fifty Years on the Savannah River Site pptx
Ngày tải lên :
17/02/2014, 19:20
... including habitat management areas for the endangered red-cockaded woodpecker (a primary habitat management area, a supplemental habitat management area, and an other-use area), the Crackerneck ... with a warming and drying climate, aboriginal populations began to increase again around 6,000 years BP By 3,000 years BP, hunting parties used the Aiken Plateau at least seasonally (Sassaman 1993), ... transient and probably concentrated along bottomlands and terraces adjacent to streams (Sassaman et al 1990; Sassaman 1993) Sustained seasonal habitation of the area began between 9,800 and 8,000 years...
- 513
- 1.7K
- 0
Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx
Ngày tải lên :
22/03/2014, 11:20
... divider Wilkinson on network analyzer, the result was relatively similar to that of the simulink model Afterthat we have measured the characteristics of the power combiner using the Winkinson bridge ... Thuy, Pham Van Thanh, Nguyen Anh Tuan, Bach Gia Duong, Research, Design And Fabrication Of The 45W And The 200W, L-Band Power Amplifier Using The Modern Microstrip Technology For Application In The ... amplitude was set at -10dB and the output one was above 16dB The adjustment of current regime may increase the amplifying coefficient even more We have also investigated the S11 factor of the power...
- 5
- 374
- 0
PERIPHERAL NEUROPATHY - A NEW INSIGHT INTO THE MECHANISM, EVALUATION AND MANAGEMENT OF A COMPLEX DISORDER doc
Ngày tải lên :
30/03/2014, 23:20
... terms of a particular pattern of activation referred to as the “pain matrix” Areas of the matrix can be classified as belonging to one of two parallel pathways that control distinct aspects of pain: ... tyrosine kinases may trigger intracellular signaling cascades that result in phosphorylation of an intracellular domain These physical modifications lead to altered activation kinetics and ultimately ... thalamus and insula [53] Similar activity patterns are observed in thermal and mechan‐ ical acute pain in healthy individuals and knee pain associated with osteoarthritis, all forms of evoked pain...
- 172
- 396
- 0
Báo cáo khoa học: "The complicated management of a patient following transarterial chemoembolization for metastatic carcinoid" potx
Ngày tải lên :
09/08/2014, 07:22
... these findings are typically managed on an outpatient basis, they can initiate a cascade of events as seen in the patient described herein that can prove life threatening More severe inflammatory ... standing, resulting in postural hypoxemia), neurological decompression illness in divers, migraine headache with aura, and refractory hypoxemia in a certain subset of patients [1,3] Hypoxemia in ... effective and safe treatment for metastatic carcinoid not amenable to resection, this case illustrates the complexity of complications that can arise A multi-disciplinary approach including ready access...
- 6
- 319
- 0
báo cáo khoa học: "Hybrid management of a spontaneous ilio-iliac arteriovenous fistula: a case report" ppsx
Ngày tải lên :
10/08/2014, 23:20
... Medical, Bloomington, IN, USA) via each CFA with the assistance of an angled catheter (Kumpe, Cook Medical) A diagnostic flush pigtail catheter was placed in his aorta via the contralateral limb A ... surgery has led to a paradigm shift in the approach to managing aneurysmal disease with a concomitant vast reduction in mortality and morbidity rates The first endovascular exclusion of an iliocaval ... reading, making editorial suggestions and approving the final manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests...
- 3
- 301
- 0
Báo cáo y học: "Conservative management of a grade V injury to an ectopic pelvic kidney following blunt trauma to the lower abdomen: a case report" ppsx
Ngày tải lên :
11/08/2014, 06:23
... vascular injuries to a segmental renal arterial branch Grade V injuries can be defined as multiple deep lacerations into the renal parenchyma resulting in a shattered kidney, as well as devascularizing ... trauma cases, with grade V injuries representing only 5% of blunt renal trauma cases Grade IV injuries can be defined as deep parenchyma lacerations involving the collecting system, as well as ... caused by low velocity impacts and has a lower rate of associated trauma to other abdominal organs [2] High-grade renal injuries including grade IV and V injuries comprise the minority of renal...
- 3
- 304
- 0
Báo cáo y học: " Control of disseminated intravascular coagulation in Klippel-Trenaunay-Weber syndrome using enoxaparin and recombinant activated factor VIIa: a case report" pptx
Ngày tải lên :
11/08/2014, 12:20
... laceration The interval of aminocarpoic acid administration is indicated by the dark grey bars The initiation (arrow #2) and duration of administration of recombinant activated factor VII is indicated ... black arrow indicates initiation of low-molecular-weight heparin (black bars) The white arrow #1 indicates the onset of bacteremia and the white arrow #2 indicates cholecystomy drainage placement ... The patient was discontinued on rFVIIa on day 79 and aminocaproic acid on day 88 While enoxaparin maintenance therapy was reconsidered, it was not initiated because of its long half-life and the...
- 4
- 294
- 0
Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx
Ngày tải lên :
11/08/2014, 17:21
... navigate the healthcare system via interdisciplinary management, including multiple subspecialists, nursing, discharge planning and insurance companies is now part and parcel of patient care In ... than a month She began having regular menstrual cycles again, and was able to maintain her weight at an appropriate level One year after discharge from the hospital, her weight was 53 kg, and ... gastrojejunoanastomosis aimed at bypassing the area of obstruction Alternative surgical management may be removal of the ligament of Treitz in order to relieve the obstruction and allow greater intestinal mobility...
- 5
- 312
- 0