... and SDC All authors read and approved the final manuscript Acknowledgments This research was supported by The French National Agency for Aids Research (ANRS, France), the charity organization ECS-SIDACTION ... step: Univariate and multivariate analyses The results of the univariate analysis are presented in Table No statistically significant difference was found between type of maintenance medication (buprenorphine ... was a determinant of non-medical use of opioids and may serve as a clinical indicator of inadequate dosage, medication, or type of follow-up Sustainability and continuity of care with adequate...
Ngày tải lên: 11/08/2014, 18:20
For a More Beautiful World
... Activities Activities Data base Interchanges Analysis of plants Information Excel How to draw a table or a graph Making the final product Product WP, PowerPoint, Cyber-Lec, Publisher Presentation ... What Do We Mean By Beautiful Preparation for Teachers Joint Research System 29 students from schools signed up Preparation for Teachers Unified Home Page Homepage Avata shop Introduction Research ... Teacher Support How to make The final product Watch Cyber-Lec Presentation Remote presentation Presentation Checklist Learning Tasks & Activities Activities Final Surveys, Essay Arrangement Sharing...
Ngày tải lên: 14/05/2015, 16:46
... microorganism 38 A2 Cultivation and fermentation media 38 A3 Encapsulating polymers and chemicals 38 A4 Coating materials 39 A5 Chemicals for assay of ethanol by gas chromatography-mass 39 spectrometry ... such as alginate and pectin, by its non-specificity towards alkaline metal or alkaline-earth metal cations where both monovalent and divalent cations are able to initiate gelation (Grasdalen and ... viscosity (Gacesa, 1988) Alginates can also be obtained from bacteria cultures (Figure 2b) The original microbial sources of alginate are Azotobacter vinelandii and Pseudomonas aeruginosa (Gacesa, 1988)...
Ngày tải lên: 30/09/2015, 06:24
Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It
... Publisher and General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... programmer pay scale Specialization can change your pay scale dramatically The difference in pay between a general gameplay programmer and an engine architect is usually $100K or more a year The more ... games are still alive Some are still making games They have pioneered a great many genres, mastered programming algorithms and design patterns, and have learned to adapt to platform after platform...
Ngày tải lên: 13/02/2014, 17:23
small business in paradise, working for yourself in a place you love (2007)
... started his career as a research assistant at a San Francisco brokerage house, earning $400 a month At a time when Silicon Valley was still farmland and called Santa Clara Valley, David became ... corporate world for a new start—and a career in paradise What’s a B&B, Exactly? PAII defines a B&B as a lodging establishment that also serves as residence for the owner-hosts and serves a breakfast ... vineyard.’” A few weeks later, William Talty had a heart attack while exercising at the gym Sadly, he passed away, and what had been a hobby for Michael Talty then became a quest The Talty family...
Ngày tải lên: 18/04/2014, 14:10
small business in paradise, working for yourself in a place you love (2007)
... started his career as a research assistant at a San Francisco brokerage house, earning $400 a month At a time when Silicon Valley was still farmland and called Santa Clara Valley, David became ... corporate world for a new start—and a career in paradise What’s a B&B, Exactly? PAII defines a B&B as a lodging establishment that also serves as residence for the owner-hosts and serves a breakfast ... vineyard.’” A few weeks later, William Talty had a heart attack while exercising at the gym Sadly, he passed away, and what had been a hobby for Michael Talty then became a quest The Talty family...
Ngày tải lên: 18/04/2014, 14:13
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease
... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write ... General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... 1.6 Admin control panel Each icon opens to a dedicated administration area of the back-end Alternate Administrator Access You can access additional areas of the administrator back-end using the...
Ngày tải lên: 29/05/2014, 23:54
báo cáo sinh học:" “More money for health - more health for the money”: a human resources for health perspective" pdf
... Global Health Workforce Alliance: The Kampala Declaration and Agenda for Global Action Geneva, Switzerland: Global Health Workforce Alliance; 2008 [http://www.who.int/workforcealliance/Kampala%20Declaration%20and ... TOTAL ODA to HRH BILATERAL ODA 684,931 MULTILATERALODA 216,403 TOTAL ODA 901,335 PERCENTAGE of ODA to HRH Source: Global Health Workforce Alliance Kampala Declaration and Agenda for Global Action ... delivery].[http://www.un org/apps/sg/sgstats.asp?nid = 4796] Global Health Workforce Alliance: The Kampala Declaration and Agenda for Global Action Geneva, Switzerland: Global Health Workforce Alliance; 2008 [http://www.who.int/workforcealliance/Kampala%20Declaration%20and...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx
... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Some fixed point-type results for a class of extended cyclic self-mappings with a more general contractive condition" pdf
... Harjani, J, Lopez, B, Sadarangani, K: A fixed point theorem for mappings satisfying a contractive condition of rational type of partially ordered metric space Abstr Appl Anal 2010, (2010) (Article ... 0 a (1 − α1 ) > − α1 and ® A ∪ A with >a ≥ 0, β1 = a0 a ≥ a1 ≥ a − A1 ∪ A2 a β1 = > It is noted that the condition (3.1) is not guarana0 − α1 teed to be contractive for any point of A1 It is also ... equality defining a circle Aa1 for a fixed a1 = a1 (x0, y0) ≤ a- a’ is defined below together with available point-dependent lower and upperbounds: De la Sen and Agarwal Fixed Point Theory and Applications...
Ngày tải lên: 20/06/2014, 22:20
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_1 pdf
... stories about start-ups that made it big, or crashed and burned, and we always think, we can that or we can better Start-ups are a high-stakes game, and you’re gambling with your time as well as your ... company’s roots Amazon, many would argue, is more of a retail company than a software company It faced extremely hard times during the dot-com crash, and continues to battle profit margins that are levels ... for a particular purpose No warranty may be created or extended by sales representatives or written sales materials The advice and strategies contained herein may not be suitable for your situation...
Ngày tải lên: 21/06/2014, 12:20
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_2 docx
... less-than-dream job Technical recruiter Barry Kwok points out that a role like an office manager at a start-up can be an easier avenue into the tech world for those who lack specific qualifications “At a start-up, ... résumé, and to potentially ask as a reference ϳGayle The Un-Manager Dear Gayle, I’m currently working at large software company in Southern California Things aren’t going so well at the company (layoffs, ... summer before I started college The pay—$12 per hour—wasn’t bad for my age but more importantly, I had a position that was actually specialized to my background Exactly one year later, I was an intern...
Ngày tải lên: 21/06/2014, 12:20
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_4 doc
... generates reports and provides visualization of real-time data ■ Implemented Hibernate mapping and Java classes to provide clean interface for interacting with database ■ Utilized JQuery and AJAX ... name, title, line number, and word position Implemented using Java API such as serialization and collections (Sortedset, Hashmaps) Achievements Won Star Associate Award at Capgemini for outstanding ... it’s hard to see the relationship between what Steve did and program management Assuming that’s his chosen career path, he could probably pick accomplishments that are a bit more relevant Finally,...
Ngày tải lên: 21/06/2014, 12:20
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_5 pptx
... expensive, and companies want to know that you’re excited about the job They hate having a candidate reject their offer almost as much as candidates hate getting rejected Moreover, enthusiastic candidates ... candidates are more likely to work hard at a job and stay at the company Companies look for enthusiasm, and researching the company, position, and people is one way to prove that Additionally, by ... make it, and how they make money? These answers sometimes appear more straightforward than they really are Amazon, for instance, makes money by reselling products at a small profit The interesting...
Ngày tải lên: 21/06/2014, 12:20
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_6 ppt
... mathematical mistakes I’m just not good at math in my head Can I ask for a calculator, or is there anything else I can do? ~W P Dear W P, You probably can’t ask for a calculator, but there are ways ... people are on an island and, one night, some are given magical hats These hats are magical because they can’t see their own hat, but they can see everyone else’s To remove a hat, one must take a swim ... they started preschool, he spent his day writing a few games and small pieces of software This candidate spun what was initially a red flag — an extended career gap — into a big plus Many of us...
Ngày tải lên: 21/06/2014, 12:20
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_7 pdf
... into a doubly linked list can dramatically increase memory usage Algorithms A recursive algorithm often takes up dramatically more space than an iterative algorithm Consider, for example, an algorithm ... what the major actions that occur in the restaurant are For example, a Party makes a Reservation with a Host The Host sits the Party at a Table and assigns them a Server Each of these actions should ... with characters That is, imagine we are cutting characters out of a magazine to form a ransom note We can solve the simplified ransom note problem with characters by simply creating an array and...
Ngày tải lên: 21/06/2014, 12:20
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_8 potx
... your research By being armed with data about industry salary and what your company offers to similar candidates, you’ll have a much better idea of what is reasonable to ask for and what isn’t ... companies Software companies like Microsoft, Google, and Facebook can afford to scatter large masses of recruiters across the country to attend career fairs and meet candidates locally; the comparatively ... be able to tactfully avoid giving your prior salary by stating that your company does not permit disclosure of salaries Have a viable alternative You can claim that you are really excited about...
Ngày tải lên: 21/06/2014, 12:20