... combination of the expected genetic merit of the commercial grandoffspring and the expected genetic merit of candidates for selection in the next generation, giving the same weight to both expected ... rules In the standard method, the breeding values of the potential grandparents were also calculated in the same way genetic x RESULTS 4.1 Infinitesimal genetic model The values of the genetic ... three females) Each generation, four combinations of potential grandparents (eight mating pairs) were selected according to the predicted genetic merit of their grandoffspring Although the most...
Ngày tải lên: 09/08/2014, 18:21
... strategy for the selection of well-settling granular sludge (Tsuneda et al., 2003) Because specific surface area of small particles is much greater than that of well-settling large particles, large ... aerobic granular sludge By setting and controlling adequate surface loading and aeration rates, small particles were effectively washed out, and well-settling sludge selectively remained in the reactor ... zone) and aeration rate in continuous upflow reactors govern the washout of sludge from the reactor, and therefore, we investigated the effect of surface loading rate and aeration rate on the selection...
Ngày tải lên: 05/09/2013, 10:15
Interest Rate Options - A discussion of how investors can help control interest rate exposure and make the most of the interest rate market pdf
... day Exercise style: European Options may be exercised on the last business day before the expiration datte Exercise-settlement: All options are cash-settled Exercise-settlement values are based ... booklet You have a variety of strategies with which to take advantage of the direction of interest rates including the future shape of the yield curve and spreads between different parts of the ... different interest rate forecasts These are only a few of the strategies that might be employed There are numerous other strategies, some more sophisticated than others, that may be used by investors...
Ngày tải lên: 06/03/2014, 14:20
HOMO LUDENS A STUDY OF THE PLAY-ELEMENT IN CULTURE doc
... staging of the whole ceremony : they have carved and decorated the masks, wear them themselves and after use conceal them from the women They make the noises heralding the appearance of the ghosts, ... became the Old French pleige whence the English pledge The oldest meaning of this is "surety" , "warrant" , "hostage", hence "gage" in the sense of a challenge or a "wager" ("wage" being a doublet ... pledge in these senses compare the Anglo-Saxon beadoweg, baedeweg =poculum certaminis, certamen 41 THE PLAY-CONCEPT AS EXPRESSED IN LANGUAGE fundamental idea of a struggle with fate limited by...
Ngày tải lên: 14/03/2014, 10:20
A study on how to make a good impression of English speaking during job interviews
... expressing feelings than spoken language Almost all verbal communication is digital and practically all body language is analogue Spoken language and body language go mostly hand in hand When someone ... choral readings of the same passages Have students tape record their oral reading, listen to it, evaluate and then repeat Daily oral and silent reading practice of at least 20 minutes! Have students ... those who have an advanced knowledge of the English language are much more likely to advance their careers In addition to this, these studies have also demonstrated that a strong command of the English...
Ngày tải lên: 18/03/2014, 10:15
Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc
... plasmon resonance (B) Ala scanning of the interaction between phage clone (2 · 1012 phage per well) and the ECL2 target peptide Data are represented as the percentage of the initial binding signal ... measuring the effect of the phage on cAMP production None of the ECL2-specific phage clones displayed agonistic properties The antagonistic properties of the selected HCDR3 phage were evaluated ... Tween 80, phage binding was detected with an anti-M13 IgG conjugated to horseradish peroxidase (GE Healthcare, Diegem, Belgium) The plates were developed with ortho-phenylenediamine (Sigma-Aldrich,...
Ngày tải lên: 28/03/2014, 22:20
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc
... unigram features All bi- and trigrams retained by our feature selection process had unigram equivalents that were eliminated due to the noise present in the automatically generated training data ... that contained a medical term (disease or symptom name) and caused the automated ICD-9 coder8 to predict a false positive code was treated as a speculative sentence and all the rest were treated ... detection of speculative assertions in radiology reports Here we generated training data by an automated procedure Since hedge cues cause systems to predict false positive labels, our idea here was...
Ngày tải lên: 31/03/2014, 00:20
Báo cáo khoa học: Selection of peptides inhibiting a b-lactamase-like activity docx
... primer AB 348, 5¢-TTAGCAAAACCTC ATACAGAA-3¢, and the backward primer AB 349, 5¢-GATGCTGTCTTTCGCTGCTGAG-3¢, were used for DNA amplification The M13 forward primer, 5¢-ATTCACCTCGAAAGCAAGCTG-3¢, was ... consequently, as a good alternative route to the rational design of small molecules based on the knowledge of the targeted catalytic mechanisms Acknowledgements We are grateful to Drs Barbee and ... corresponding to the sequences of seven negatively selected peptides (Table 3), displaying the best signals in phage ELISA, were synthesized according to the following feature: NH2GACXnCGAAGAEKCONH2,...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC ... AS-9 AS-10 AS-11 AS-12 AS-13 AS-14 AS-15 TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ... 5¢-AATTCCATGCCTATGATACTGGGAT-3¢ GSTM1-forB 5¢- CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB...
Ngày tải lên: 31/03/2014, 15:20
báo cáo sinh học:" Burnout and training satisfaction of medical residents in Greece: will the European Work Time Directive make a difference?" pot
... general practice and primary and preventive care are severely underdeveloped in Greece [22] Notably, a recent study has demonstrated the need for a 619% increase in Greek generalist physicians ... A strong lack of coordination between these alternative forms of health care delivery has generated a number of challenging structural problems in the Greek health sector [18] Furthermore, general ... Table Significantly higher burnout rates were observed in Greek residents surveyed in the present study compared to Greek internal medicine specialists and Greek healthcare employees It is generally...
Ngày tải lên: 18/06/2014, 17:20
A Treatise on the Theory of Invariants by Oliver E. Glenn pot
... opportunity has been taken to emphasize a logical development of this theory as a whole, and to amalgamate methods of English mathematicians of the latter part of the nineteenth century–Boole, Cayley, ... relief several defining properties of an invariant 1.1.1 An invariant area Given a triangle ABC drawn in the Cartesian plane with a vertex at the origin Suppose that the coordinates of A are (x1 ... exceedingly large and classical division of pure mathematics, have been consulted extensively I have deemed it expedient, however, to give only a few references in the text The student in the...
Ngày tải lên: 28/06/2014, 19:20
Báo cáo toán học: "A quantitative ergodic theory proof of Szemer´di’s e theorem" pot
... der Waerden’s theorem, and so we have elected to proceed by the simpler and “purer” route of using van der Waerden’s theorem directly Also, as remarked above, the argument as presented here seems ... a more Readers familiar with the Szemer´di regularity lemma may see parallels here with the proof of that e lemma Indeed one can phrase the proof of this lemma in terms of conditional expectation; ... there is a great deal of flexibility in executing the above abstract scheme, and this explains the large number of variations between the known proofs of Szemer´di e type theorems Also, each of...
Ngày tải lên: 07/08/2014, 13:21
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... immunohistochemistry were only available in nine cases) Thirty four patients were stage and 32 were stage at the time of presentation Distant metastases developed in 13 cases between 14 and 60 months after ... stage and age at diagnosis were adjusted for, it was shown that African American (AA) women have increased odds of having features associated with a poor prognosis, including overexpression of ... cyclin E expression and the younger age (< 35 years) of patients When specific types of metastases were analysed, high cyclin E predicted the risk of distant metastases with borderline significance...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo sinh học: " Expected efficiency of selection for growth in a French beef cattle breeding scheme. I. Multistage selection of bulls used in artificial insemination" docx
... increase when progeny test capacity increases More males are evaluated on maternal performance and thus the uncertainty in preweaning parameters has a larger impact The same comments can be made ... only a section of the whole breeding scheme of a beef breed was considered, ie the multistage selection of AI bulls The next paper will present calculations of expected genetic gains for the selection ... predicted selection response Some idea of the variance of predicted response is required to plan and justify a breeding progam Assuming that genetic parameters are really known, variability of selection...
Ngày tải lên: 09/08/2014, 18:21
báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test" potx
... selected was 0.20 in both lines line, The traits selected, egg laying between and 11 days after adult emergence and adult weight at 12 days, were given equal weights in the aggregate genotype ... response was always larger in the index line than in the independent culling line The difference between average gains in egg laying was significant (tabl 3) The mean value for adult weight increased ... laying In the line selected by independent culling levels the selection differentials for egg laying exceeded those for adult weight, as was expected because of the greater value for the phenotypic...
Ngày tải lên: 09/08/2014, 22:22
Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot
... active anti-retroviral treatment (HAART) regimens are characterized by a good tolerance of relatively low levels of adherence to therapy, although resistance selection may ensue when adherence drops ... quasispecies may ensue after a very short exposure to EFV, in the absence of wild type depletion, likely providing relative replicative advantage Our case therefore suggests that the presence of ... quasispecies [5] Along a different line of evidence, Hatano et al recently demonstrated that failing NNRTI-based HAART regimens not confer clinical residual advantage, at variance with PIbased...
Ngày tải lên: 11/08/2014, 14:21
báo cáo khoa học: " Does harm reduction programming make a difference in the lives of highly marginalized, at-risk drug users?" pot
... a range of HIV-related services (e. g. , HIV testing, primary medical care, case management, drug treatment, legal services, and housing); • Assistance in accessing entitlement benefits (Medicaid; ... life areas based on measures that were culturally appropriate and meaningful to them Using the drug-user-generated outcomes from Phase I, instruments were developed to collect data at several ... to traditional drug treatment and leaves harm reduction initiatives at a disadvantage As a result, considerable research has been conducted to develop outcomes of drug treatment and assess its...
Ngày tải lên: 11/08/2014, 20:20