lump sum payment of principal and interest at specified date
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Ngày tải lên :
16/03/2014, 13:20
... Met95 mutations, although the effects of the Leu99 and Leu115 mutations were modest compared with those of Met95 mutations It seems likely that potential data based on our data and that of others ... substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table 2) The rates of auto-oxidation ... suggest that the rate of binding of Met95 to the 5-coordinated Fe(II) complex (His77 as an axial ligand; complex b in Fig S2) is fast and occurs in the order of microseconds, whereas the rate of CO...
- 14
- 390
- 0
WORKING PAPER SERIES NO 748 / MAY 2007: FINANCIAL DOLLARIZATION THE ROLE OF BANKS AND INTEREST RATES docx
Ngày tải lên :
22/03/2014, 23:20
... that in CS as of June 2006 around 80% of local currency loans had a foreign currency indexation clause that linked repayments of principal and interest to the evolution of the dinar exchange rate.24 ... variance of M (SM,M ) is assumed to be 33% higher than the variances of real exchange rate and inflation, which were assumed to be equal The correlation of real returns and real exchange rate (ρM,S ... SM,S leads to more dollarization On the other hand, if inflation and real investment returns are negatively correlated, then when inflation is low and interest rate payments are high the investment...
- 76
- 738
- 1
SECLUSIONSAND RESTRAINTS: Selected Cases of Death and Abuse at Public and Private Schools and Treatment Centers pot
Ngày tải lên :
23/03/2014, 03:20
... laws at the state level We also identified at least five states that currently collect and report information related to the use of seclusions and restraints in public and private schools At the ... collect and report this type of information include Kansas, Pennsylvania, and Rhode Island, but we did not obtain data from these states Cases of Death and Abuse Related to the Use of Restraints and ... Department of Family and Protective Services alleged that the victim’s death was because of physical abuse, the official certificate of death stated that it was an accident and a grand jury declined...
- 62
- 422
- 0
Depression and stress among the first year medical students in university of medicine and pharmacy at hochiminh city, vietnam
Ngày tải lên :
23/07/2014, 03:36
... descriptive and analytical statistic In analytical statistic, data were tested in bivariate and multivariate analysis Descriptive statistics such as frequency, percentage, mean, and standard deviation ... divorced and 1.4% for separated parent Quality of relationship with parents About the satisfaction of relationship with parents, the percentage of students very satisfied more than percentage of satisfied ... Cham and Cambodian with 8.1% Living status Living status included variables as hometown, living location, type of accommodation, and whom student lived with Hometown and living location Most of...
- 106
- 722
- 0
Báo cáo khoa học: "The combination of deoxynivalenol and zearalenone at permitted feed concentrations causes serious physiological effects in young pigs" ppt
Ngày tải lên :
07/08/2014, 20:23
... AGCTCTGGGAAACTGAATGACTTC MGB Probe: AATTCCGGTAGATAATCT Primer-R: TGATGAGTTCACTGATGGCTTTG X53085 TNF-α Primer-F:GATCATCGTCTCAAACCTCAGATAAG MGB Probe: TGTAGCCAATGTCAAAGC Primer-R: GGCATTGGCATACCCACTCT ... with a UNG incubation step at 50 C and 10 o AmpliTaq Gold Activation at 95 C, followed by a 2o o step temperature cycling (15 sec at 95 C, at 60 C) and 35 cycles to complete polymerization Histology ... pigs as a result of the ingestion of a mixture of DON and ZON From our yearlong collection and analysis of feeds from pig farms, we concluded that there are approximately mg/kg DON and 250 µg/kg...
- 6
- 179
- 0
Báo cáo sinh học: "Genetic variability of age and weight at puberty, ovulation rate and embryo survival in gilts and relations with production traits" pot
Ngày tải lên :
09/08/2014, 18:22
... lutea, the number of living embryos (NE) at 30 days of gestation and embryo survival rate (ES) defined as the ratio of number of embryos to ovulation rate The structure of the data studied is shown ... noting that the correlation between growth rate and weight at puberty is the result of two antagonistic relationships, ie, a slight negative relationship between growth rate and age at puberty and ... association between OR and NE and a lower relationship between OR and ES than in most other studies at 30 days of gestation (Young et al, 1977), 50 days of gestation (Neal et al, 1989) or at birth...
- 13
- 398
- 0
báo cáo khoa học: "Full recovery of a 13-year-old boy with pediatric Ramsay Hunt syndrome using a shorter course of aciclovir and steroid at lower doses: a case report" pot
Ngày tải lên :
10/08/2014, 22:24
... attributed to bystander involvement of the vestibulocochlear nerve [6], which Table Chronology of events from onset of illness Day Event(s) Sore throat Sore throat - - Resting head on hands at ... population We cited the review in part to highlight that there is insufficient data on the pediatric population Conclusions This case report documents the clinical manifestations and outcome of ... the sore throat resolved, during supper, it was noted that he would rest his head on his hands at the table, unlike his usual self The next day, our patient woke up and reported that his face...
- 4
- 275
- 0
USING SEMANTIC MAPPING TO TEACH ESP VOCABULARY TO FINAL-YEAR STUDENTS OF FINANCE AND ACCOUNTING AT HANOI TOURISM COLLEGE
Ngày tải lên :
19/03/2015, 10:33
... procedures of treatment and data collection in the teacher-researcher‟s classroom was clarified Finally, means of data analysis as descriptive statistics, specifically statistic values of mean, mode and ... vocabulary instruction strategy was reviewed, of which definitions of semantic mapping, procedures of creating a semantic map and previous studies of benefits and limitations of semantic mapping were ... mapping used as vocabulary instruction strategy in which definitions of, procedures of creating semantic maps, and previous studies of benefits and limitations of semantic mapping were mentioned in...
- 71
- 893
- 5
IN INVESTIGATION INTO INTONATION AWARENESS OF TEACHERS AND STUDENTS AT FACULTY OF FOREIGN LANGUAGES AT INDUSTRIAL UNIVERSITY OF HO CHI MINH CITY
Ngày tải lên :
10/07/2015, 14:50
... communicative competence and proficiency He mentions firstly, the role of intonation and discourse, secondly, models of communicative competence and proficiency, and finally the guidelines of intonation ... reports that teachers not have enough detachment to evaluate learner‟s pronunciation That is also because of students‟ motivation and aptitude that might determine the acquisition of intonation (Skehan ... attitudes, and personality factors (Carter &Nunan 2001 62) Apparently, current treatments of intonation are quite limited and for that reason intonation awareness has not been paid a lot of attention...
- 55
- 597
- 0
Using semantic mapping to teach ESP vocabulary to final-year students of finance and accounting at Hanoi tourism college
Ngày tải lên :
04/08/2015, 09:42
... INTRODUCTION Rationale of the study Aims and objectives of the study Scope of the study Research questions Significance of the study The method of ... perceptions of the benefits of semantic mapping to their word retention 34 3.2 Discussion 36 PART C: CONCLUSION Summary of the study 38 Limitation of the study and ... TABLE OF CONTENTS Page Declaration i Acknowledgements ii Abstract iii Table of contents iv List of abbreviations vii List of tables...
- 8
- 509
- 5
An investigation into the attitudes of teachers and students at the hanoi college of industrial economics towards speaki
Ngày tải lên :
19/12/2015, 12:50
... to attain the communicative objects of the curriculum, engage learners in communication and require the use of such communicative processes as information sharing, negotiation of the meaning and ... information of the subjects of the study, the instruments used to collect the data Chapter provides an analysis on the current situation of teaching and learning speaking at first year classes at ... the attitudes of teachers and students at the HCIE towards the speaking skills in ELT; the attitudes of teachers and students at the HCIE towards the speaking skills in the textbook NH Pre and...
- 56
- 565
- 1
using pair work and group work techniques to increase students' participation and interest in communicative english classes at hanoi university of industry
Ngày tải lên :
06/02/2014, 14:45
... Simulation and role-playing are important techniques for creating a variety of social relationships and situations I Students’ participation and interest I Concept of students’ participation ... activities and their attention to what is happening in the class I.2 Concept of students’ interest Ellis (1994) ( cited in Keller, 1984) states that interest is one of the main elements of motivation and ... students’ interest and participation in activities II Limitations of the study Because of the limitation of time, this study has some limitations It only investigated the current situation of using...
- 43
- 1.6K
- 5
study on effects of capitation payment method on cost and indicators of health insurance services at four district hospitals inthanh hoa province
Ngày tải lên :
25/07/2014, 13:57
... degree of compliance with inpatient disease-based treatments, average days of treatment and patients’ satisfaction, etc The findings show that: the degree of compliance with treatments and treatment ... techniques and communication However, utilization of medical records is still one of the primary methods of evaluation In healthcare, the expectations of patients on the quantity and quality of provided ... number of medical visits in commune, district inpatient and outpatient, provincial and central hospitals; - The growth rate of total cost in commune; district inpatient and outpatient; provincial and...
- 29
- 369
- 0
Precluding and reducing solutions to credit risk at Quang Trung branch of Vietnam Bank of Investment and Development.doc
Ngày tải lên :
27/10/2012, 16:49
... bank However, according to the present regulation of the State bank and the Charter of Organization and Operation of Bank for Investment and Development of Vietnam, the transaction centers not have ... organization of profession and transaction process, helping to build Bank for Investment and Development of Vietnam for sustainable and integrated development 2.1.2 Content and scope of operation ... Development of Vietnam”, operating according to the regulation of organization and activities promulgated by the Management Board of Bank for Investment and Development of Vietnam; and according...
- 47
- 892
- 14
Techniques for developing content reading skills for the third year students at the university of odonto and stomatology
Ngày tải lên :
07/11/2012, 14:50
... to update them and meet the demand of their work Being aware of the great importance of ESP in the teaching career, the students’ study and their future jobs, teachers at the University of Odonto ... skills and strategies used in the L1 + types of reading skills and strategies used or appropriate in the L2/FL + beliefs about the reading process (use of inference, memorization, nature of comprehension) ... design, materials writing or adaptation and evaluation” (Hutchinson and Waters, 1987: 157) So it is important that the ESP teacher must know something about the subject matters of the ESP materials...
- 49
- 1.2K
- 2
An investigation into the reality of teaching and learning speaking skills to the 2nd year non-major english students at pre-intermediate level of proficiency at hanoi university of industry
Ngày tải lên :
07/11/2012, 14:50
... CONTENTS CANDIDATE’S STATEMENT i ACKNOWLEGDEMENTS ii ABSTRACT iii LIST OF ABREVIATIONS iv LIST OF FIGURES AND TABLES v TABLE OF CONTENTS vi PART ONE: INTRODUCTION I Rationale of the study II Aims of ... NATIONAL UNIVERSITY, HANOI COLLEGE OF FOREIGN LANGUAGES DEPARTMENT OF POST GRADUATE STUDIES CANDIDATE’S STATEMENT I certify that the minor thesis entitled: “An investigation into the Reality of ... What you think of the materials used for teaching and learning Speaking to the 2nd year non-major English students at Pre-Intermediate level of Proficiency at your University? A Difficult and...
- 20
- 2.4K
- 27
Organizing pairwork and groupwork in the context of high school classrooms at pham van nghi upper secondary school, nam dinh province: A case study
Ngày tải lên :
07/11/2012, 14:54
... that communication is used in a number of senses and at a number of levels to indicate the transmission of information or even, as in the transport networks example, the transmission of goods and ... questionnaires 24 The scheme and coding catergories in this research emerged from an examination of data rather than being pre- determined and imposed on the data 2.3 Presentation of statistical results ... Communicative Language Teaching means little more than an integration of grammatical and functional teaching Littlewood (1981:1) states, “One of the most characteristic features of communicative...
- 62
- 1.4K
- 6
A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY
Ngày tải lên :
10/04/2013, 14:46
... VIETNAM NATIONAL UNIVERSITY, HANOI COLLEGE OF FOREIGN LANGUAGES DEPARTMENT OF POSTGRADUATE STUDIES CANDIDATE S STATEMENT I hereby state that I: Nguyen Thi Viet Ha, Class 14A, being a candidate for ... response on relation between test score and their achievement v TABLE OF CONTENT CANDIDATE S STATEMENT ACKNOWLEDGEMENT ABSTRACT LIST OF ABBREVIATION LIST OF TABLES AND CHARTS TABLE OF CONTENT Chapter ... type of test presents a lack between at least some candidates productive and receptive skill and therefore the performance on an MCQs test may give an inaccurate picture of these candidates ability...
- 64
- 1.1K
- 1