locked nucleic acid a synthetic rna mimic for high affinity mirna targeting
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps
Ngày tải lên :
12/08/2014, 04:21
... 5’-TTGGTTACCATGCAAACAAYT-3’ 91-111 Antisense 5’-TRTCTTGGGCRTGTGTAACA-3 152-171 Probe 119-143 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3-3’ a Y = T or C, R = A or G LNA residues in the probe are indicated ... assay failed to detect virus in a nasal swab and a throat swab (Table 1) This may be due to RNA degradation during long-term storage and multiple freezethaw cycles Tran Tan et al Virology Journal ... influenza virus in Asia: implications for pandemic control Proc Natl Acad Sci USA 2006, 103(8):2845-2850 Li KS, Guan Y, Wang J, Smith GJ, Xu KM, Duan L, Rahardjo AP, Puthavathana P, Buranathai C,...
- 5
- 460
- 0
báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps
Ngày tải lên :
11/08/2014, 12:21
... Cancer, Ovarian Cancer and Leukemia SPOREs, and by a 2009 Seena Magowitz Pancreatic Cancer Action Network AACR Pilot Grant Author details RNA interference and non-coding RNA Center and the Department ... on a platform of assembled RNA devices formed by a modular sensor (aptamer) and a gene-regulatory (hammer ead ribozyme) component This device con h verts a small-molecule input to an increased ... vitro, and finally adoptively transferred into a cancer patient However, the clinical efficacy of ACT, so far, has been limited There are many reasons for this, and insufficient persistence and reactivation...
- 3
- 239
- 0
Báo cáo y học: "A novel informatics concept for high-throughput shotgun lipidomics based on the molecular fragmentation query language" ppt
Ngày tải lên :
09/08/2014, 22:23
... MasterScan: a database of shotgun mass spectra The MasterScan is a flat file database that stores all mass spectra acquired from all analyzed samples, including technical and biological replicates, ... available for testing local installations of the software LipidXplorer benchmarking: the dataset E coli total lipid extract was purchased from Avanti Polar Lipids (Alabaster, AL, USA) and analyzed ... demonstrated that LipidXplorer takes full advantage of the high mass resolution and mass accuracy of a hybrid tandem mass spectrometer It has also become apparent that averaging and alignment of related...
- 25
- 514
- 0
Modelling study of a container distribution system for high rise factories
Ngày tải lên :
26/11/2015, 12:46
... models are available, they should be used, and that simulation should be resorted for cases where either analytical models are not available and approximations are not acceptable or they are so ... 2.1) obtained from Mannesmann Demag (a company that manufactures and installs container hoists) shows that Hong Kong has many high- rise factories and warehouses that utilize container cranes to ... (through a large ramp for container trucks), private loading areas and car parks The ramp has to be wide enough to accommodate the turning radius of 40-ft trucks and large access roads have to...
- 80
- 276
- 0
How to prepare and organize a successful speaking lesson for high school students
Ngày tải lên :
30/11/2015, 09:14
... teacher roles during a speaking lesson A teacher can act as an organizer, a prompter, an observer, a participant, an assessor, a feedback provider, and the last, a resource Teachers can act as ... words Teachers act as an observer means that the teachers can analyze what causes communication breakdown Teachers can act as a participant means that the teachers not monopolize or initiate the ... motivation and build a motivate attitude Next, manage classroom and manage time Managing classroom and managing time in this stage are paid attention to because this stage is the signal for the ending...
- 48
- 458
- 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
Ngày tải lên :
18/06/2014, 16:20
... analysis OSNA runs were repeated from discordant sample homogenates and afterwards RNA was isolated and subjected to qRT-PCR for CK19, CEA, and beta-actin Conditions for CK19, CEA and beta-actin ... and (++) for mRNA copies/μL higher than 5000 Quantitative reverse-transcriptase polymerase chain reaction as part of discordant case investigation (DCI) DCI was performed after the original analysis ... tissue is much harder compared with formalin fixed material and requires a special training The OSNA lysate can be asservated and in unclear cases RNA isolation for further diagnostics is possible...
- 6
- 535
- 0
Báo cáo y học: "Nucleic acid chaperons: a theory of an RNA-assisted protein folding" ppt
Ngày tải lên :
13/08/2014, 23:20
... CT CT AG CT X CT ACT AG XAG G CT X AG AGX CTX X X G CT T G G T G C A A CT A A C C AC AT A G T T C G A A T G A T A T T A C A G CG C T G A 3rd 2nd C G A A T G A T A T T A C A G CG C T G A G 2nd ... temporary attachment points between the RNA and protein (for example a basic amino acid) while the blue circles indicate amino acids with exceptionally high affinity for the attachment points (for ... example acidic amino acids); these capture the amino acids at the attachment point and dissociate the ribonucleoprotein complex Transfer-RNAs are of course important participants in translation,...
- 11
- 236
- 0
A dynamic programming algorithm for RNA structure
Ngày tải lên :
12/01/2014, 22:07
... calculate the gap matrices For a given gap matrix, we have to consider all the different ways that its diagram can be assembled using one or two matrices at a time (Again, Feynman diagrams are ... bifurcation diagram in wx (left) with an additional diagram (right) to take into account such a coaxial stacking con®guration The coaxial scoring function depends on both base-pairs (Coaxial diagrams ... bases can also appear inside multiloop diagrams Notice also that the coaxial diagram in equation (11) really corresponds with four new diagrams because once we allow pairing, dangling bases also...
- 16
- 688
- 0
Báo cáo khoa học: In vitro embryonic developmental phosphorylation of the cellular nucleic acid binding protein by cAMP-dependent protein kinase, and its relevance for biochemical activities pdf
Ngày tải lên :
16/03/2014, 12:20
... by PCR amplification Oligonucleotides used for mutant generation were: forward 5¢-CGCGGATCCGCATGGACATGAGTACC AG-3¢, and reverse 5¢-GGAATTCCTACGCAGACGCTT CGATGGCGCAGTCTCTCGC-3¢ cDNAs coding for CNBP ... 12 Yasuda J, Mashiyama S, Makino R, Ohyama S, Sekiya T & Hayashi K (1995) Cloning and characterization of rat cellular nucleic acid binding protein (CNBP) cDNA DNA Res 2, 45–49 13 Tomonaga T, ... nuclear ribonucleoprotein A1 catalyzes RNA. RNA annealing Proc Natl Acad Sci USA 89, 895–899 36 Pontius BW & Berg P (1990) Renaturation of complementary DNA strands mediated by purified mammalian...
- 13
- 500
- 0
protocols for nucleic acid analysis by nonradioactive probes
Ngày tải lên :
11/04/2014, 10:14
... Controlled areas Both imply restricted access, separate storage facilities for radioisotopes, and careful management of the use to which the laboratory is put To maintain a separate laboratory away from ... 2.2 RNA Preparation and Blotting Chapters and describe the preparation of plant and animal RNA Chapter also gives details on the further purification of the mRNA (i.e., polyadenylated) fraction ... isolation of plant RNAs Nucleic Acids Res 17, 2362 &LWTER Isolation of Total and Poly A+ RNA fromAnimal Cells Ian Garner Introduction Most RNA in a mammalian cell consists of 28S, 18S, and 5s...
- 260
- 329
- 0
Báo cáo sinh học: " Discovery of herpesviruses in multi-infected primates using locked nucleic acids (LNA) and a bigenic PCR approach" pdf
Ngày tải lên :
18/06/2014, 18:20
... CCTCCCAGGTTCARTWYGCMTAYGA CCGTTGAGGTTCTGAGTGTARTARTTRTAYTC AAGATCAACCCCAC(N/I#)AG(N/I)GT(N/I)ATG GTGTAGTAGTTGTACTCCCTRAACAT(N/I)GTYTC 700 500 CCATCCAGATCCARTWYGC(N/I)TAYGA GATGTTCTGCGCCTRRWARTTRTA ... MfasLCV-1 Macaca fascicularis lymphocryptovirus MfasRHV-1 Macaca fascicularis rhadinovirus MfasRHV-2 Macaca fascicularis rhadinovirus PhamLCV-1 Papio hamadryas lymphocryptovirus PhamLCV-2 Papio ... TGGCTGCCAAGCG(N/I)(N/I)T(N/I)GG(N/I)GA GATGTTCTGCGCCTGRWARTTRTAYTC 650 CGCAAATCGCAGA(N/I)KC(N/I)TGGTG TGGTTGCCCAACAG(N/I)ATYTCRTT TTCAAGGAACTCAGYAARAT(N/I)AAYCC CGTTGTCCTC(N/I)CC(N/I)ARYTG(N/I)CC...
- 15
- 426
- 0
A new electrolyte formulation for low cost cycling lead acid batteries pps
Ngày tải lên :
05/07/2014, 20:21
... batteries to increase installation reliability and performance A new patented acid formulation, using 4% of colloidal silica and 2.2% of phosphoric acid, was developed and tested in standard automotive ... of acid strati®cation and positive active mass softening Results of the analysis are reported in Table Colloidal silica at 2, and 6% plays a beneficial role for capacity evolution (Fig 2) and ... expensive for widespread use Valve regulated lead acid batteries using flat plates combined with gel or Adsorptive Glass Material (AGM) giving no maintenance but medium reliability (about years at...
- 7
- 449
- 0
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
Ngày tải lên :
09/08/2014, 14:22
... Institutional Animal Care and Use Committee Autoantigen microarrays Antigens were printed in ordered arrays on FAST slides (Whatman, now part of GE Healthcare, Piscataway, NJ, USA) Arrays were blocked ... past years, PJU has served as a consultant to Centocor, Inc (Horsham, PA, USA), Biogen Idec (Cambridge, MA, USA), Avanir Pharmaceuticals (Aliso Viejo, CA, USA), Amgen (Thousand Oaks, CA, USA), ... lupus autoantigen microarrays that contained more than 50 candidate SLE autoantigens A table containing raw median pixel intensity minus background values for all array antigens is provided [see Additional...
- 10
- 408
- 0
Báo cáo y học: "A scaling normalization method for differential expression analysis of RNA-seq data" pps
Ngày tải lên :
09/08/2014, 20:21
... statistical analysis (for example, Fisher’s exact test; see Materials and methods for more details) Normalization factors across several samples can be calculated by selecting one sample as a ... Bolstad BM, Irizarry RA, Astrand M, Speed TP: A comparison of normalization methods for high density oligonucleotide array data based on variance and bias Bioinformatics 2003, 19:185-193 Wang ... BioMart and Bioconductor: a powerful link between biological databases and microarray data analysis Bioinformatics 2005, 21:3439-3440 CRAN - Package statmod [http://cran.r-project.org/web/packages/statmod/...
- 9
- 518
- 0
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc
Ngày tải lên :
09/08/2014, 23:20
... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA- Seq and microarray platforms have emerged as important tools for detecting changes in gene expression and RNA processing in biological ... [http://www.ebi.ac.uk/ena/ data/view/ERP000619] 28 Affymetrix - Sample Data, Exon 1.0 ST Array Dataset [http://www affymetrix.com/support/technical/sample_data/exon_array_data.affx] 29 Akira S, Takeda K: ... of the Barres Lab (Stanford), Myers Lab (HudsonAlpha Institute), Ravits Lab (Benaroya Institute) and Maniatis Lab (Harvard/Columbia) for providing data and/or user feedback This work was supported...
- 12
- 394
- 0
Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx
Ngày tải lên :
12/08/2014, 04:20
... control of analytical results in the medical laboratory Eur J Clin Chem Clin Biochem 1996, 34:983-999 13 Koshy A, Grover S, Hyams KC, Shabrawy MA, Pacsa A, al-Nakib B, Zaidi SA, al-Anezi AA, al-Mufti ... HT, Lu Q: An outbreak of enterically transmitted non -A, non-E viral hepatitis J Viral Hepat 1999, 6:59-64 Tanaka T, Takahashi M, Kusano E, Okamoto H: Development and evaluation of an efficient ... read and approved the final manuscript 16 17 Acknowledgements This work was supported by funds from National Center for Clinical Laboratories 18 Author Details National Center for Clinical Laboratories,...
- 5
- 311
- 0
Báo cáo y học: " Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays" pptx
Ngày tải lên :
12/08/2014, 04:21
... 5'-GGTACAGGGTCCCCAATCTTCGATAACTAACATTGGGATTCCCGAGATTG-3' 5'-ATCTCGGGAATCTCAATGTTAGTTATCGAAGATTGGGGACCCTGTACC-3' 5'-CCGGAATTCGGTTTAAATGTATACCCAAAGACAAAAG-3' 5'-CGACTCCTGGAGCCCG-3' 5'-TGACACCAGACCAACTGGTAATG-3' Note: ... phages Linear Analysis of the Lambda DNA Phage Using a Hepatitis B Virus DNA Fluorescence Quantitative Diagnostic Kit To evaluate the performance of armored DNA as a calibrator for HBV DNA assays, ... Heermann K, Heath A, WHO Collaborative Study Group: An international collaborative study to establish a World Health Organization international standard for hepatitis B virus DNA nucleic acid amplification...
- 7
- 264
- 0
Báo cáo sinh học: "iTriplet, a rule-based nucleic acid sequence motif finder" pptx
Ngày tải lên :
12/08/2014, 17:20
... discovery algorithm for sequential data Bioinformatics 2006, 22(1):21-8 Davila J, Balla S, Rajasekaran S: Fast and practical algorithms for planted (l, d) motif search IEEE/ACM Trans Computational Biology ... polyA tail addition to the upstream fragment [25] Two main sequence motifs are important for cleavage/polyadenylation of mammalian mRNAs The highly conserved and well-understood AAUAAA motif (called ... [14] Transfac ID: R08298 c-fos serum response element promoter+5' UTR Remarks CCATATTAGGACATCTGCGT CCAAATTTG CCATATTAGGACA CAGGATGTCCATATTAGGACATC model Ref [17] Ref [14] Transfac ID:...
- 14
- 262
- 0