locations and capacity of large breweries

Tài liệu Stability and Control of Large-Scale Dynamical Systems pptx

Tài liệu Stability and Control of Large-Scale Dynamical Systems pptx

... Thermodynamic Modeling of Large- Scale Interconnected Systems 4.1 Introduction 4.2 Conservation of Energy and the First Law of Thermodynamics 4.3 Nonconservation of Entropy and the Second Law of Thermodynamics ... system (2.64) and (2.65) with respect to xI uniformly in xII0 The remainder of the proof involves similar arguments as given above and as in the proof of parts ii) v) of Theorem 2.3 and, hence, ... for Discrete-Time LargeScale Dynamical Systems 9.1 Introduction 9.2 Conservation of Energy and the First Law of Thermodynamics 9.3 Nonconservation of Entropy and the Second Law of Thermodynamics...

Ngày tải lên: 12/02/2014, 16:20

389 724 0
Audit Stewardship and Oversight of Large and Innovatively Funded Projects in Europe ppt

Audit Stewardship and Oversight of Large and Innovatively Funded Projects in Europe ppt

... executive officer of Thompson Engineering, Inc and president and chief financial officer Audit Stewardship and Oversight of Large and Innovatively Funded Projects in Europe | 33 Te a m M e m b e r s of ... Inspector, Office of Counsel General, and the Highways General Department (Planning and Budget, Finance, and Operations) shared their experiences and processes on audit stewardship and oversight of large ... Source: OFFICE OF THE COMPTROLLER AND AUDITOR GENERAL, IRELAND Figure Value for money Audit Stewardship and Oversight of Large and Innovatively Funded Projects in Europe | 23 Findings and Recommendations...

Ngày tải lên: 23/03/2014, 04:20

60 285 0
Báo cáo hóa học: " Research Article On the Throughput Capacity of Large Wireless Ad Hoc Networks Confined to a Region of Fixed Area" pptx

Báo cáo hóa học: " Research Article On the Throughput Capacity of Large Wireless Ad Hoc Networks Confined to a Region of Fixed Area" pptx

... an arbitrary function of n and ρ, and let b1 and b2 be constants (quantities independent of n and ρ) We have the following lemma relating upper bounds on transport capacity and throughput Lemma ... (for a given ρ) of n, this completes the proof of the lemma , where we have used (31) in the last step The proof is complete Let C T be sample mean of the “quantum” of the transport capacity CT,ii ... [11] H Zhang and J C Hou, Capacity of wireless ad-hoc networks under ultra wide band with power constraint,” in Proceedings of 24th Annual Joint Conference of the IEEE Computer and Communications...

Ngày tải lên: 22/06/2014, 00:20

11 464 0
Báo cáo lâm nghiệp:"Performance and physiology of large containerized and bare-root spruce seedlings in relation to scarification and competition in Québec (Canada)" pot

Báo cáo lâm nghiệp:"Performance and physiology of large containerized and bare-root spruce seedlings in relation to scarification and competition in Québec (Canada)" pot

... consisted in removal and deposition of the organic layer and some underlying mineral soil in berms beside the trench In each of the nine blocks of RP and 10 blocks of LC, we randomly assigned the ... contained 37% sand, 47% silt, and 26% clay Both soil profiles were characterized by a mor humus layer of cm Experimental sites RP and LC were clearcut-harvested in the summers of 1996 and 1997, respectively, ... use of large seedling stock will help reduce the need for repeated release treatments and therefore presents an advantage to the use of standard-size seedlings [26] Finally, the use of either large...

Ngày tải lên: 08/08/2014, 01:21

11 267 0
báo cáo khoa học: " Identification of tissue-specific, abiotic stressresponsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets" docx

báo cáo khoa học: " Identification of tissue-specific, abiotic stressresponsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets" docx

... under-counting of abundant transcripts and over-counting of rare ones, they violate the assumption of random sampling, and as such, are not usually considered for use in tag frequency analyses of gene ... verified by random sampling and sequencing of 96 and 285 clones from both the primary and the normalized libraries, respectively, and comparing their redundancy rates Root EST sequencing and data ... clustering analysis and data interpretation and finalization of the manuscript GRC participated in the organization of the studies and finalization of the manuscript JCC conceived and organized the...

Ngày tải lên: 11/08/2014, 11:20

23 404 0
Climate vulnerability and capacity of ethnic minorities in the northern mountainous region of vietnam

Climate vulnerability and capacity of ethnic minorities in the northern mountainous region of vietnam

... analysis of the vulnerability and capacity of men and women in ethnic minority groups, and puts forward a set of recommendations for addressing the particular vulnerabilities and capacities of these ... flood and landslide events, the rehabilitation and recovery of productive land is not supported This has serious implications, and can require months of hard labour to clear rubble and sand As ... experiences to develop a picture of trends and patterns that are emerging This informs the analysis of climate vulnerability and capacity, and new and emerging data and research are tracked by the...

Ngày tải lên: 08/09/2015, 23:30

28 388 0
On the performance and capacity of space time block coded multicarrier CDMA communication systems

On the performance and capacity of space time block coded multicarrier CDMA communication systems

... resolved 1.4.1 Performance and Capacity in the Presence of Carrier Frequency Offset The performance and capacity of STBC MC-CDMA systems in the presence of carrier frequency offset is studied There ... receivers of base station Simulation results show the robustness and effectiveness of the estimation algorithm in the presence of near-far problems, multipath fading and large number of users ... effect of ISI will be minimized Since the large number of filters and oscillators necessary have to be used for a number of subcarriers, an efficient digital implementation of a special form of multicarrier...

Ngày tải lên: 16/09/2015, 15:54

242 240 0
Effect of dissolved organic matter (DOM) and biofilm on the adsorption capacity of powdered activated carbon in activated sludge

Effect of dissolved organic matter (DOM) and biofilm on the adsorption capacity of powdered activated carbon in activated sludge

... effect of biofilm on the adsorption capacity of PAC, PAC covered with biofilm was made and its adsorption capacity was compared to the adsorption capacity of new PAC repeated times For biofilm ... this study is to clarify the effect of DOM and biofilm on the adsorption capacity of PAC in the aeration tank of PACT process Materials and methods 2.1 Operation of powdered activated carbon treatment ... (DOM) and biofilm attached onto PAC However, it is not clear that the effect of DOM and biofilm attached onto PAC were decrease in adsorption capacity of PAC in the aeration tank The objective of...

Ngày tải lên: 05/09/2013, 08:40

10 557 0
Numerical simulation and optimization of CO2 sequestration in saline aquifers for enhanced storage capacity and secured sequestration

Numerical simulation and optimization of CO2 sequestration in saline aquifers for enhanced storage capacity and secured sequestration

... to rise up to the ceiling (caprock) of the aquifer and forms a large spreading plume, decreasing both the storage capacity, safety and economic feasibility of SAGCS considerably To address this ... the mobility, viscosity, and relative permeability of the non-wetting phase (CO2) respectively and mw, µw, and krw are the mobility, viscosity, and relative permeability of the wetting phase (brine) ... optimization of the storage efficiency of an aquifer is of great interest in GCS Therefore, a simulation tool that has the capability of determining the optimal solutions by balancing various trade-offs...

Ngày tải lên: 05/09/2013, 16:10

12 577 0
Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx

Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx

... morbidity and mortality of tuberculosis is the source of major medical and social problems, especially in developing countries It is ranked as the seventh highest cause of morbidity worldwide, and ... morbidity and mortality It will be important to develop and utilize novel, more sensitive and specific tests Considering the serious impact of missed or delayed diagnoses and the risk of transmission ... located in the central region of the Kingdom of Saudi Arabia (KSA), provides multilevel health care for National Guard soldiers and their extended families It has one of the largest critical care units...

Ngày tải lên: 15/02/2014, 12:20

6 506 0
Tài liệu Báo cáo khoa học: Peptides corresponding to helices 5 and 6 of Bax can independently form large lipid pores pdf

Tài liệu Báo cáo khoa học: Peptides corresponding to helices 5 and 6 of Bax can independently form large lipid pores pdf

... X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death Nature 381, 335–341 Suzuki M, Youle RJ & Tjandra N (2000) Structure of bax Coregulation of dimer formation and intracellular ... the usefulness of short peptides as simple model systems in helping us to understand fundamental aspects of complex functional mechanisms Results and discussion Peptides of helices and from Bax ... conditions, values of % 40% total helical structure, considering both regular and distorted a-helix, are calculated in the case of Bax-a5 and % 20% in the case of Bax-a6 (Table 1) The presence of even moderate...

Ngày tải lên: 19/02/2014, 07:20

11 586 0
Đề tài " Global well-posedness of the three-dimensional viscous primitive equations of large scale ocean and atmosphere dynamics " doc

Đề tài " Global well-posedness of the three-dimensional viscous primitive equations of large scale ocean and atmosphere dynamics " doc

... comments and suggestions This work was supported in part by NSF grants No DMS-0204794 and DMS-0504619, the MAOF Fellowship of the Israeli Council of Higher Education, and by the USA Department of Energy, ... and uniqueness (regularity) of strong solutions to the three-dimensional viscous primitive equations, which model large scale ocean and atmosphere dynamics Introduction Large scale dynamics of ... Annals of Mathematics, 166 (2007), 245–267 Global well-posedness of the three-dimensional viscous primitive equations of large scale ocean and atmosphere dynamics By Chongsheng Cao and Edriss...

Ngày tải lên: 06/03/2014, 08:21

24 421 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... presence of CI More precisely, the )21 to )48 and )52 to )87 regions of the top strand and )24 to )53 and )58 to )87 regions of the bottom strand were protected by CI (Fig 3B) The centers of these ... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig ... first base of the start codon of Cro was considered as +1 and the whole sequence was numbered with respect to +1 that the intensities of six bottom strand guanine bases and five top strand guanine...

Ngày tải lên: 07/03/2014, 00:20

11 432 0
Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

... small and large lipid particles, respectively Interaction of ApoE3 and ApoE4 with EggPtdCho/TO lipid emulsions Direct binding analysis of ApoE3 and ApoE4 to large emulsion particles The binding of ... interaction of apoE3 and apoE4 isoforms with large EggPtdCho/TO emulsions was examined Figure 7C shows the flotation velocity data of EggPtdCho/ TO fraction in the presence and absence of 1.0 lM ... by dynamic light scattering Because of the size of the emulsion particles, diffusional broadening of the flotation profiles is not very large, and variation of the diffusion coefficient throughout...

Ngày tải lên: 08/03/2014, 09:20

11 600 0
Greasy palms - The social and ecological impacts of large-scale oil palm plantation development in Southeast Asia docx

Greasy palms - The social and ecological impacts of large-scale oil palm plantation development in Southeast Asia docx

... 17% of all species of birds, 12% of all species of mammals, 16% of all species of reptiles, and 16% of all species of amphibians.36 PNG covers only 0.3% of the Earth's surface but holds 5% of ... Sawit Watch Indonesia and Joanna de Rozario on behalf of Friends of the Earth England, Wales and Northern Ireland © Friends of the Earth January 2005 All rights reserved No part of this report may ... Mha of land, half of which was forestland Only 7% of the area burnt was grassland CIFOR furthermore estimated that 447,000 hectares of estate crops were burnt in 1997-1998.69 D.2 The role of oil...

Ngày tải lên: 08/03/2014, 10:20

54 2,3K 0
Báo cáo " Preparation of nano-structural MnO2 in ethanol-water media coated on calcinated laterite and study of its arsenic adsorption capacity " docx

Báo cáo " Preparation of nano-structural MnO2 in ethanol-water media coated on calcinated laterite and study of its arsenic adsorption capacity " docx

... solutions of MnSO4 and KMnO4 Therefore, working solutions of Mn(II) are series of 0, 5, 10, , 100 % of ethanol in 3.10-2 MnSO4 solution Similarly, working solutions of Mn(VII) include series of 0, ... suitable amount of dried denaturated laterite with size of 0.5 – 1.0 mm diameter and dropped into colloidal solution of MnO2 Then softly shook the mixture in 60 When almost of MnO2 particles ... for the preparation of nanodimentional particles of oxides and sulphides of metals, US Patent 5643508, 1997 [4] S Koktysh Dmitry, R McBride James, J Rosenthal Sandra, Synthesis of SnS nanocrystal...

Ngày tải lên: 14/03/2014, 10:20

6 516 0
Synthesis of large scale sic–sio2 nanowires decorated with amorphous carbon nanoparticles and raman and PL properties

Synthesis of large scale sic–sio2 nanowires decorated with amorphous carbon nanoparticles and raman and PL properties

... agreement with the results of XRD and TEM Two peaks centered at $1337 and $1592 cmÀ1 often called as D- and G-band, respectively confirm the existence of carbon [22–25] The D-band is known as to appear ... intensity ratio of two bands, ID/ IG, can be expressed as follows: ID CðkÞ ¼ La IG where C(k) is 4.4 nm for incident laser wavelengths of 514 nm [28,29] The intensities of the D-band and G-band were ... 5, spectrum (a) and (b) were recorded from two kinds of nanowires Strong enhancement of blue emission band at about 482 nm (2.58 eV) and appearance of a new yellow emission band centered at about...

Ngày tải lên: 16/03/2014, 15:08

5 623 0
w