list of likes and dislikes of a person
An Assessment of the Environmental Implications of Oil and Gas Production: A Regional Case Study pot
Ngày tải lên :
06/03/2014, 16:20
... Oil and Gas Extraction Operations). Note that FRB
data are only at the national level.
For natural gas lease and plant, extrapolated 2002 to 2006 using the EIA national
estimate of natural gas ... Montana and the Dakotas are part of Region 8 as well,
these states have some distinct features. Most of Montana has characteristics of the
Rockies, but the eastern areas of both Montana and ...
OPEI Office of Policy, Economics, and Innovation (EPA)
OSHA Occupational Safety and Health Adminstration (DOL)
OW Office of Water (EPA)
PAH Polyaromatic hydrocarbon
Pb Lead
PM Particulate matter...
- 115
- 744
- 0
Báo cáo khoa học: Photosynthetic acclimation: Structural reorganisation of light harvesting antenna – role of redox-dependent phosphorylation of major and minor chlorophyll a/b binding proteins pot
Ngày tải lên :
16/03/2014, 06:20
... been
unsuccessful to date. Nevertheless, by adopting an
alternative approach, a small family of three thyla-
koid-associated kinases (TAKs) have been identified
in A. thaliana as candidates for LHCII kinases
through ... sub-
strates of these two protein kinases remain to be
determined.
The common structural features of all the LHCII
kinases characterized to date are a putative single
transmembrane domain and a large ... Lack
of the light-harvesting complex CP24 affects the struc-
ture and function of the grana membranes of higher
plant chloroplasts. Plant Cell 18, 3106–3120.
67 Takahashi H, Iwai M, Takahashi Y &...
- 13
- 343
- 0
Lagrangian analysis and prediction of coastal and ocean dynamics a griffa, et al , (cambridge, 2007) WW
Ngày tải lên :
05/05/2014, 14:42
... chapters, and for maintaining a quality
standard of scientific work. Finally, we thank all the scientists who have played
important roles in the advancement of Lagrangian observations and analysis,
but ... Rossby
LAGRANGIAN ANALYSIS AND
PREDICTION OF COASTAL AND
OCEAN DYNAMICS
Edited by
ANNALISA GRIFFA
Rosenstiel School of Marine and Atmospheric Science
University of Miami
Istituto di Scienze Marine, ... information about
lateral (isopycnal) mixing, and almost certainly more can be discerned about
small-scale stirring, interleaving and mixing processes using Lagrangian plat-
forms of observation and analysis.
32...
- 525
- 1.2K
- 0
Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt
Ngày tải lên :
20/02/2014, 01:20
... clipping of a
fragment of desired length and sequence from a nat-
ural RNA may be a useful application. For example,
RNA fragments that involve modified nucleobases are
easily obtainable from naturally ... aptamer and siRNA tech-
nologies have been developed and have found applica-
tion in molecular medicine [1–7]. Signalling aptamers
and aptazymes have been constructed that can sense a
number of ... sequencer (Pharmacia Biotech) as described pre-
viously [15]. Data were processed and analysed using dna
fragment analyzer 1.2 Software (Pharmacia Biotech).
Kinetic constants of ligation reactions...
- 11
- 481
- 0
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx
Ngày tải lên :
08/03/2014, 10:20
... strong
far-reaching results can be obtained on the basis of a few elementary assumptions
about preference structure, but it is not at all clear that they are in fact a
suitable way of encapsulating ... iÔerent instances
of equilibrium that leave a trace of a process.
The comparative statics method is sometimes incorporated into speci…c re-
lationships that are used as a shorthand to characterise ... not mean that all features of a model
should be or could b e subjected to rigorous empirical test. The standard meth-
ods of quantitative investigation can reveal a lot about the detail of agents’
behavioural...
- 668
- 5.1K
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
Ngày tải lên :
25/10/2012, 10:06
... preclinical and clinical
trial work along this line of inquiry.
Education and educational research
What becomes obvious is that a lack of research has
impact and implications for the education of both ... manuscript. Dana
Lawrence performed thematic analysis and coding of tran-
scripts and prepared components of the manuscript. Rob-
ert Rowell also performed thematic analysis and coding of
transcripts and ... assessment,
documentation, and treatment of chest pain/discomfort
cases, and appropriate and timely referral of chest pain
patients as needed.
An extensive body of primary empirical literature
addresses patient...
- 10
- 788
- 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
Ngày tải lên :
14/02/2014, 03:20
... was maintained by
using beryllium metal foil to seal the X-ray optical path.
Table 2. Summary of DSC data, suggested results, and additional characterizations
sample no. peak onsets (°C) peak ... nitrogen
purge.
Evolved Gas Analysis. Simultaneous TG/MS and TG/gas
chromatography (GC)/MS analysis were performed on several
samples. A split was used to send a fraction of the evolved
gases to a quadruple mass ... patterns would imply the presence of an
amorphous material and/ or an impurity. Note that both of these
samples also have atypical preparations (see Table 1). Additional
analyses would be needed to interpret...
- 16
- 549
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
Ngày tải lên :
18/02/2014, 11:20
... group of the ribose moiety of A7 6 of tRNA
Arg
by rotation around Ca–C. When Pa of ATP gains
access to O1 of C@O1 of the a- carboxyl group of Arg,
and two oxygen atoms of Pb and Pc are coordinated
by ... group of
A7 6 of tRNA and the carboxyl group of Arg induces both formation of
Arg-AMP (Arg + ATP fi Arg-AMP + pyrophosphate) and pyrophos-
phorolysis of Arg-AMP (Arg-AMP + pyrophosphate fi Arg + ATP) ... isoacceptor
tRNA
UCU
and tRNA
CCU
contain nine (AGCAGGAC
2 0a
A)
and 10 nucleotides (AGCCA
1 7a
GGAC
2 0a
A), respectively.
The P. horikoshii tRNA
Arg
CCU
gene (5Â-GGACCGGTAG
CCTAGCCA
1 7a
GGAC
2 0a
AGGG CGGCGGCCTCCTAAG
CCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCG
CCA-3Â)...
- 17
- 512
- 0
Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt
Ngày tải lên :
18/02/2014, 16:20
... dimethylation of Arg, monomethylation, dimethylation
and trimethylation of Lys, acetylation and ubiquitina-
tion of Lys, and phosphorylation of Ser and Thr [16–
18]. Combinations of these modifications ... radiofrequency electrostatic
fields rather than with static magnetic and electric
fields. High-quality ECD spectra often require the
averaging of data from large numbers of scans
acquired over a ... involves capture of the electron
into an amide carbonyl group that is hydrogen bonded
to the protonated side chain of a basic amino acid.
The resulting radical anion abstracts a proton and gen-
erates...
- 8
- 578
- 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
Ngày tải lên :
19/02/2014, 05:20
... structures of a bacterial 6-phosphogluconate
dehydrogenase reveal aspects of specificity, mechanism
and mode of inhibition by analogues of high-energy
reaction intermediates
Ramasubramanian Sundaramoorthy
1
, ... parameters (B-factors) and, where
appropriate, the ligand occupancies.
Superposition of subunit A on B and C (468 Ca
atoms) in complex II and III of LlPDH gives an rmsd of
1.6 A
˚
in each case, ... be an associated water molecule. Our
interpretation was that the smaller compound PEA
(Fig. 1B) and a water molecule are present and PEX
and PEA refined satisfactorily with occupancies of 0.7
Table...
- 12
- 452
- 0