Ngày tải lên: 23/03/2014, 02:20
Ngày tải lên: 23/03/2014, 21:20
CONCRETE IN HOT ENVIRONMENTS - List of Relevant Standards pps
Ngày tải lên: 08/08/2014, 10:22
Means of transport available in Hanoi.DOC
... persons, of different ethnic minority groups being the political, economic, cultural and social center of Lao Cai province. The Hoang Lien saw range of mountains dominates the district, which is ... express trains ( 5,6 ) were put into operation by VietNam Raiways.Each train had 8 cars inclucding 2 soft berth cars 2 hard berth cars, 1 soft seat car (double – cleck car ) , 1 hard seat car , ... variety of cars by Viet Nam rail and private companies like Tulico Ratraco and Victoria hotel.You can choose according to your couvenience and budget. VICTORIA TRAIN The Victoria express train offers...
Ngày tải lên: 03/09/2012, 09:19
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
... medical wastes in Vietnam Public economics Table of Contents What is medical waste 2 Definition of medical wastes 2 Definition according to Wikipedia 2 Definition according to Ministry of ... by allocating more and more supervisors for the 4 processes of containment, collecting, transporting and treating in wastes centres. Firstly, in the process of waste classification in hospitals, ... should also be invested in to find out the best technologies for reducing abatement cost and increasing the effect and efficiency of medical waste treatments. 4. Conclusion Medical waste disposals...
Ngày tải lên: 23/09/2012, 15:38
The Volatility of Capital Flows in South Africa: Some Empirical Observations
... been reduced by nearly two-thirds since the currency crisis of 1998. Nevertheless, the NOFP and other indicators of international reserve adequacy remain a source of concern for investors ... billion in the NOFP was typically associated with a decline in spreads of nearly 15 basis points. 2 This means that the cut in the NOFP from its recent peak of US$23 billion (18 percent of GDP) in ... corresponding outflow elsewhere in the capital account, or even the current account. In the case of FDI, this could happen if foreign investors wished to avoid taking an open position in South Africa;...
Ngày tải lên: 24/10/2012, 09:11
Báo cáo y học: "Facing medical care problems of victims of sexual violence in Goma/Eastern Democratic Republic of the Congo"
... 5:2 http://www.conflictandhealth.com/content/5/1/2 Page 5 of 5 SHOR T REPOR T Open Access Facing medical care problems of victims of sexual violence in Goma/Eastern Democratic Republic of the Congo Inipavudu ... Lin YC, Polonsky J, Coppens K, Encinas L, Rodrigue MN, Pedalino B, Mondonge V: Violence against civilians and access to health care in North Kivu, Democratic Republic of Congo: three cross-sectional ... 45:219-224. doi:10.1186/1752-1505-5-2 Cite this article as: Baelani and Dünser: Facing medical care problems of victims of sexual violence in Goma/Eastern Democratic Republic of the Congo. Conflict and Health 2011...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "Refractive Status and Prevalence of Refractive Errors in Suburban School-age Children"
... rural children in mainland China. Optom Vis Sci. 2009; 86: 40-44. 18. National Bureau of Statistics of China. China statistical year- book 2003 [in Chinese]. Beijing: China Statistics Press. 2003: ... u tho r s ind i c a t e n o financial conflict of interest. This study supported in part by a grant (2007CE9070) from the Chongqing Science and Technology Commission. Competing Interests ... results of epidemiological studies from China [8, 9, 10] and the prevalence of myopia is higher in China, indicating that differences in ethnicity, regional and economical differences and development...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"
... still re- mains unclear (4), particularly in HBeAg-negative CHB patients. In contrast, a large body of evidence showed the incidence of hepatic steatosis in chronic hepatitis C (CHC) patients ... Inc., Chicago, IL, USA). Baseline cha- racteristics and anthropometric indices were ex- pressed as means ± standard deviation (SD) or per- centage frequency, if necessary. The baseline charac- teristic ... prevalence of hepatic steatosis in Hispanics was mainly due to the higher prevalence of obesity and insulin resistance in this ethnic group (3). But, that how does hepatic steatosis influence CHB...
Ngày tải lên: 25/10/2012, 11:48
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... difference in the accuracy of certificated cause of death between urban and rural counties; (3) large fluctuations in Chinese social cir- cumstances during the decades before 1980, with large changes ... Acknowledgments We thank Cancer Research UK, the UK Medical Research Council, the US National Institutes of Health, the Chinese Ministry of Health, and the Chi- nese Academy of Medical Sciences who supported ... results. Second, 5.7% of urban and 13.5% of rural cancer deaths in our study were diagnosed only by clinical experience, or inference after dying, which may result in misclassi- fication, and...
Ngày tải lên: 26/10/2012, 09:48
Báo cáo y học: "Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits"
... drug reactions. Among such reactions, phlebitis induced by intravenous infusion of antineoplastic agents re- duces the completion of chemotherapy. The causative factors of phlebitis include the ... //www.medsci.org 219 Introduction Chemotherapy, including novel antineoplastic agents, is becoming increasingly effective for cancer and is performed widely, but adverse drug reactions are ... words: antineoplastic agents, phlebitis, vinca alkaloids, anthracyclines, corticosteroid, rabbit ear vein, vinorelbine, doxorubicin Int. J. Med. Sci. 2009, 6 http: //www.medsci.org 221 of venous...
Ngày tải lên: 26/10/2012, 09:57
Luận văn tiếng Anh thương mại Solutions to improve effectiveness of consumer credit in Vietnam.doc
... socio-economic development Plan in 2009 are illustrated in 3 aspects: (1) Preventing economic recession and maintaining rational and sustainable economic growth rate; (2) Maintaining macroeconomic ... is arranging loans into specific groups according to certain criteria. A science-based classification is the precondition for organizing a proper credit-granting process and improving credit ... training in assessment of the 8 CHAPTER 2: CONSUMER CREDIT ACTIVITIES IN VIETNAM’S COMMERCIAL BANK SYSTEM This chapter will give an insight into consumer credit activity in Vietnam’s commercial...
Ngày tải lên: 27/10/2012, 16:45
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"
... 5’-TGAAGGAGACCCTGACCAAC-3’; COBRA1 reverse 5’-ATCGAATACCGACTGGTGGA-3’; ANK3 forward 5’-GGAGCATCAGTTTGACAGCA-3’; ANK3 reverse 5’-TTCCACCTTCAGGACCAATC-3’; STAU2 forward 5'-CCGTGAGGGATACAGCAGTT-3'; ... anticancer drugs including vinblastine, topotecan, paclitaxel and doxorubincin in human hepatocellular carcinoma derived cell lines . The resistance against anticancer drugs has been associated ... STAU2 reverse 5’-GCCCATTCAGTTCCACAGTT-3’; HMGN3 forward 5’-TGCCAGATTGTCAGCGAAAC-3; HMGN3 reverse 5’-TGCTCCACCAAAACCTGAACCAAAC-3. All primers were synthesized by MWG Biotech AG (Ebersberg,...
Ngày tải lên: 31/10/2012, 15:28
Environmental and Social Impacts of Shrimp farming in Tam Giang lagoon, Vietnam-Local perception
... stakeholders’ concerns about environmental and socio-economic impacts of shrimp farming; the causes of those impacts and links to institutions (customary and official), policy and farming practices. ... fishermen could not collect fry and the productivity of fishing in commune went down. Findings from group discussion shown that 224 ha of Con in Ba Con area in Vinh Ha have been completely converted ... shrimp farming Social Conflicts of interests related to shrimp farming Economic Shrimp farming success and failures resulting in wealth disparity and debt problems Technical Existence of diversified...
Ngày tải lên: 02/11/2012, 10:15
Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis
... result of hepatitis B (HBV) virus infection is development of hepatocellular carcinoma (HCC). However, the reason of development of HCC in HBV infected patients is still unclear. Recently, ... and 3’-CATAGCATTATCCTTCGGTTC (API2) were used to detect cIAP2. Primers with the sequence 3’-GGGAAGCAGAGATCATTTTGC (API3) and 3’- AACTGAGTATATCCATGTCCC (API4) were used to detect XIAP. PCR bands ... Int. J. Med. Sci. 2005 2(1) 34 caspases by the direct binding of IAPs. In the many case, for example, in the lung carcinoma cells, the interaction of the over- expressed cIAP2 with caspase...
Ngày tải lên: 02/11/2012, 11:17
Báo cáo y học: "Management of HBV Infection in Liver Transplantation Patients"
... reduce or eliminate HBV replication prior to OLT should result in a lower incidence of reinfection. The characteristics of ideal antiviral agent(s) would include low toxicity in the setting of ... finding of circulating HBV DNA by PCR in 2 of 11 receiving HBIG and 5 of 10 receiving LAM suggests that reinfection would be likely in additional patients with longer observation. Discontinuation ... defined as an absence of detectable HBV DNA at the time of OLT and absence of reinfection for a minimum of 6 months post-OLT. After one year, reinfection occurred in 20% of patients in each...
Ngày tải lên: 02/11/2012, 11:17
Báo cáo y học: "Ocular manifestations of Lyme borreliosis in Europe"
Ngày tải lên: 03/11/2012, 11:11
Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"
Ngày tải lên: 03/11/2012, 11:17